Transcript asmbl_11985

Sequence
Transcript Sequence for observation asmbl_11985 of TGE0003610:
CAAAGGACTCAGGTGCAGGCTTCCCTAACGGACTAGTCTCGCACCTAAAGAAGAAAGAAAATGGCCTGTGCCGAGTATTCTTTTCATGTGCCGAGTCTAGAGGAGCTTGCTGGAGTTCTACAGAAGGGACTAAAGGATAACTTTGCTGACGTCCAGGTTTCTGTAGTTGATTGCCCTGATTTGACTAAAGAGCCATTTACCTTTCCTGTGAAAGGCATCTGTGGGAAAACTAGAATTGCAGAAGTAGGAGGTGTGCCTTACTTATTGCCTCTTGTAAATAGAAACAAAGTCTATGATCTAAATAAGATTGCAAAAGAAATCAAGCTTCCTGGAGCTTTTATTCTTGGAGCGGGGGCAGGCCCATTTCAGACTCTCGGGTTCAATGCTGAGTTTATGCCAATTGTTCAAACAGAAAGTGAACACAAACCTCCTGTGAATGGAAGTTACTTTGCCCGTGTTAACCCTGCAGATGGAGGATGCTTACTAGAGAAATACAGTGAGAAATATCGTGATTTTGGGTGTGCATTACTGGCTAATCTTTTTGCCAGTGAGGGCCAACATGGAAAGGTCATTGAGGTGAAAGCCAAAAGAAGAACTGGAAAACTTAACTTTGTGACTTGTATGAGACAGACTCTTGAAAAACATTATGGAGATAAGGCTGTAGGGATGGGAGGTACTTTCGTAATTCAGAAGGGAAAAGTGAAGACTCACATTATGCCTGCAGAATTTCCTTCCTGCCCTTTGAACTCTGAGGAAAAGGTGAATGAATGGTTGAATTTTTATGAGATGAAGGCTCCTTTGATTTGTCTGCCAGTTTTTGTCTCCAAAGACCCAGGATTTGATTTGCGATTGGAGCACACTCACTTTTTCAGTCATCATGGAGAAGGTGGACACTACCATTATGACATTACCCCAGATATAGTAGAATATCTTGGCTACTTCTTACCTGCGGAGTTTCTTTATCGCATTGATCAACCAGAAGAGACCCATTCATATGGGCGAGATTAAATCAACTGATCAGCATTTAGAAAAAGAAGTGATTAACTAAAGTTAATTAAATGATTAACTCATTAATTGCTACAAATATAAAGTTCAATAGAAATGATCTTACTACTTAAACCCTATTTTTTTGGCCTTTGAAATGAAAGGTATGTTGACATTACTCTGTTATTTCATAGATCTGAAAAAGTTTCTTGGGAACAAAGATATATAATGGAGATGTTCTTCATTATTTTTTTATTCTAAAAATCAGTCTTATATTTATACCTTAAATATAAACATGATCTGGAATCATGTGATTGGTTAATTTTACTAACAGTAATAATTTACACTTAACATTATTAATTTTTTCAAATTAGTCTCACAACTGCTAATTGGGTATTTCTGGGTACTAGAAAAATCAGTGTTGGAAATTTTGATAGTTGTTGAATCTTTGTATTGAATTTTAAAAGTCTATTTTAGGAGTCAGAGTACACTTTTTTCATGGAATAAGGTGATCAGAAGGAGCAACTTTACCCCTTTTGGTGAAGTTGAACCATACTCAGAGTTTGCAGTTTGCCTTGTACAAACATTAGCAACTAGACAGTTAGCCATGATTCCTCTTTTGTTTGGATCGCCAACTGGAAGCAGTTTGTACCTTATTAGTTATTTGGAAGAAGAAAGCGGGGAAAAGAAACAGCATCAAAATACAACACTGAAGTGAGTATAATTTCTAAGTGAGGCTGTTGTTACACATGACCACTGTCCTTTGTGAAATATAAAATTATATTTGAATACATTTGTTACTGGTTATAATGGTTGAAATTTTCTTCAGTGTTCTTCTGTAATAATCATTAGTAAGAAATCAACTGTAATCTTATTAATGCCAACAATGTGCAGATTTAGGAGCTCTTCAGTACTAAGCACATAATAAATCAAAAAATATTATTTGATTGTCTTCTCTGGATGTAAGCTATAACATATCCTTT