Transcript asmbl_11595

Sequence
Transcript Sequence for observation asmbl_11595 of TGE0003598:
GGGACTCGGCGGTGTTGGGTAGTTCCGGTAGGGCGGGGCGCGGCCGAGGTCCCCAGACCAGAACTGGAGAGGATATTCGGGATCCCTACTCCGCTAGTGGAGAAAGGACCTGCCTCCCACGCACCCTCACCTAACCAGAGCGGGGATTTCTATGGCCCCTCCTGCTGGCTTTTTGAAGAAAGCGAAAGTGAAAGAGGGAAGAAGACTGAGGAGATCGCGGCGCCATGAAGCACCTGTCCCTGCTCCTCGCTCTGGCTTTGGGCTTGGTGACCGCCGTCTCGGCGGGACCCACGGTGATAGAATGCTGGTTCGTGGAGGATGCAGACGGGGGCCGCCTGGCCAAGAAACCCGCTGCATTGCTGCTGCGCCAGGGCCCAGGGAGAATACCTCCCCGGCCGGACCTCGACCCCAAGCGCTACCTCAGAGTACATGACCCCACAGGCACCCTGCAGGCTGCCTTCAGGCGGTACCCCCGGAGCGCCCCCACGCCACACTGCGAGATGAGCCATTACATCCCACTCCCCGCCTCTGTGAATTGGGTCAAAGGCCTGACTCCGGAGCAGAGCTGCCCGCGGGCCTTGGACGGGACTTGGTTCATGGTCAGCATGTCCAGCCCGGTCCTCAGCCTCTCCAGCCTCCTACAATCACAGACCGAGCCTCAGCCAGATCCTGGACTCATCACCATGGCAACAGCTGTGCTGACTGTCATCACCCACAACCCCACCACTAGAATCCAGCTGGGACAAGATGCTCTGCTGGACTTGAGCTTTGCTTACATGCCCTCCACCCCAGAGGCCACTACACCTCTGGCCCCAGGTCCCCCTCCCTTTGGGCTGGAGTGGCGACACCAGCACCTAGGGGAGGGGCACCTGCTCCTGGCTGCAACTCCTGGGCTGCGTGGGCAAATGCCAGCTGCCCGAGATGGGGCAGTGGCATTTGCCGCTTGGGATGATGATGAGTCATGGGGTCCATGGACTGGAAATGGGACCCTCTGGCTGCCTGCAGTGAAGCCTTCCCAGGAGGGTGCCTATCAGGCCACCATATACCTGCCATATCTGCAAGGACAGGTCACCCTGGAGCTTGCTGTGCAGAAATCCCCCAAAGTGTCCCTGATGCCATCACCTCTTGTATGGGCTGCCCCTGGGGAGGCACCCCCTGAGCTAGTTTGCCTTGTGTCCCACTTCTACCCCTCTGAGGGCCTGGAGGTGGAGTGGGAGCTCCGAGGTGGTCCAGAGGGGAGCTTTCAGAAGGCCAAGGGGCAGAGTTGGCTCTCAGCCCTGCACCACCACTTGGATGGCTCTGTCAGCCTCTCTGGGCACCTGCAGCCATCCCCGGTCACCACTGCACAGCACGGGGCGCGCTATGCCTGTCGTGTCCACCACCCCAGCCTACCCGCATTGGGGCGCAGTGCTGAAGTCACCCTGGAGGTGGCAGGTCTCTCTGGCCCCTCCCTGGAGGATGGTATAGGCCTCTTCCTGTCTGCTTTTCTGCTCTTGGGGCTCTTCAAGGTACTGGGCTGGGCAGCTGCCTACCTGTCCACTTCCAAGGAATCAAAGAAGAAAGCACAGTGAGGGCACTCAAGACCACCCTGGGGAAGCTACCATCATCTCTGACCTGAACTACTGTAGTAGCTCCTCCAAACAGTATGCCATCACCTGCTCCTGCTCCTGCTCCTTCCAATCTCTCTCCACGGTGGGAATGCTTTTTTAAAAAAGACACAAATCTATAGCATTCACCTTCTTAGAGCTCTAAGGCTGTGGTTCTCAAAATTTTTGGTCTCAGGACATCATAAAAACGAAGGACTCTCGAGCTTTTGTTTATGTGGGTTATAAACTAACTATTTATCATACTAGAACTTAAAACTGAGAAAAGTTTAAAACAGAAGGATACACAGGCACACATTCCATTGGCTGTGAAGGAGATAATGTCAATACACATCATGTAGCTCTGGGAAATTTCACTGTACATTTTTTTAGAGAATGAAAGTGAAAAAGGCAAATAACATTTTAGTGTTATGAAAATAGTCTTAACTTCGTATGCGCAGTGAATTAGTCTCAGAGATCTCTGGGGCAGGGACCACACCAAGAGAACGGGTGCTCTAGAGGCCAAATCCATTCTTCTTGCCCTTGGCACATGAATTTACGGCGCTGGAGCCACTGCTTACCTCTTCAACCCAATCTGGTGCTCTCCAGCACTCTCAATACTCATCACACCTACAGCTCTTCCTTTCCTCCAATGGCCTCTCACCTTCCCTAGGTCCCAGAGTTCTGTTCTCTCTGCCTGGTCCACCCTCGCTCTCCCTGGGCTCCAGACCAGATCAGCCAAGTCATTCCCCTCAGACCGCCGCGTGTCCCTCTTGTGCGGTTCACCACGGTTGTACTTAAGTGATTGTGCGAGTTGTTAAAGCCCGTTTCCCGGACTCTCAGCTCCTCGCAGTTGCAAAAACAAGTCTGTATGTCCACTGCTTTATCTCCCGCATCGGCAGTGGGCCTGGCGCCCACTGGAGGGCGCTCGGTATAAGAAGTTATAGTCCTTTTTTTCATCCTAAGGATTCAAAAACAGGTATAGGGTCAAGTAACTACTGGACGAAGGAAGCGGCGACTTAAGGACCTCCGAGGGGCAGGACCGTGGGCCAGACCGACGCGGGGAGCGAGTCTACTCGGTGGGAATAAAGTTGTGTTCCAGTGCTTC