Transcript asmbl_11550

Sequence
Transcript Sequence for observation asmbl_11550 of TGE0002354:
CCGAAGAGTGACACAGTATTCCCCACTTGGAGAACACCTCTAATGGAACTTGCTTTTTTCTCCAGCCTTGCGACCAGCCTGTTTTCGCCTCGCACCGTAGCTGCTCGGCCTTGCAGGTGGGGTTCTTCTTTTCTCAACTCCCCAAGCCTTGACGAGTTGAACGGCGGGGGCCGGAAGTGTGCGCTGCAGCTTCAGGTCCCTAGCGAATCGACACCGGAAGTAGCCGTTGCTGGAGAATAATTCCGCCGGCATCGCTATGGCGGCGATCCCGCCAGACTCCTGGCAGCCTCCCAACGTATACTTGGAGACCAGCATGGGGATCATTGTGCTGGAGCTGTACTGGAAGCATGCTCCAAAGACCTGTAAGAACTTTGCTGAATTGGCTCGTCGAGGTTACTACAATGGCACCAAATTCCACAGAATCATCAAAGACTTCATGATCCAGGGAGGCGACCCAACAGGGACAGGTCGAGGTGGTGCATCTATCTATGGCAAGCAGTTTGAAGATGAACTTCATCCGGACTTGAAATTCACAGGGGCTGGAATTCTTGCAATGGCCAATGCAGGGCCGGACACCAATGGCAGCCAGTTCTTTGTGACCCTAGCGCCCACCCAGTGGCTTGATGGCAAACACACCATATTTGGCCGTGTGTGCCAGGGTATAGGAATGGTGAATCGAGTAGGAATGGTGGAAACAAACTCCCAGGACCGCCCTGTGGATGATGTGAAGATCATCAAGGCATACCCTTCTGGGTAGTCTTGCTGCTGTCTTGGGTACACCCAGGTCTTCTCAGAGGGCCCCAGAGAACCAGCTTCCAAATGACCTAGAATGACGTGTAATTCTAAACTTCACTTTGGCCTTGCAAAAGCATGGAGCTAAGGAATCATGGGGTCTTAGTTGAGTTAGAGATGGAAGTGTATTTTAATAGGATGCTTCTTTTCTCTTGGAGCCTAGGTTGATAGACCATTGGCAGAAATGCCCACACATGATTGTACACAGGTTACTGCTCACTGCACATGACCCATACTGCTCCTTTTTGTGTATAT