Transcript asmbl_38680

Sequence
Transcript Sequence for observation asmbl_38680 of TGE0001787:
CCGGGGGCGGGGCCAGGCTATAAACCGCCGGTTAGGGGCCGCCATCCCCTCAGAGCGTCGGGATATCGGGTGGCGGCTCGGGACGGAGGACGCGCTAGTGTTCTTCTGTGTGGCAGTTCAGAATGATGGATCAAGCTAGATCAGCATTCTCTAACTTGTTTGGTGGAGAACCATTGTCATATACCCGGTTCAGCCTGGCTCGGCAAGTAGATGGCGATAACAGTCATGTGGAGATGAAACTTGCTGTAGATGAAGAAGAAAATGCTGACAATAACACAAAGGCCAATGTCACAAAACCAAAAAGGTGTAGTGGAAGTATCTGCTATGGGACTATTGCTGTGATCGTCTTTTTCTTGATTGGATTTATGATTGGCTACTTGGGCTATTGTAAAGGGGTAGAACCAAAAACTGAGTGTGAGAGACTGGCAGGAACCGAGTCTCCAGTGAGGGAGGAGCCAGGAGAGGACTTCCCTGCAGCACGTCGCTTATATTGGGATGACCTGAAGAGAAAGTTGTCGGAGAAACTGGACAGCACAGACTTCACCGGCACCATCAAGCTGCTGAATGAAAATTCATATGTCCCTCGTGAGGCTGGATCTCAAAAAGATGAAAATCTTGCGTTGTATGTTGAAAATCAATTTCGTGAATTTAAACTCAGCAAAGTCTGGCGTGATCAACATTTTGTTAAGATTCAGGTCAAAGACAGCGCTCAAAACTCGGTGATCATAGTTGATAAGAACGGTAGACTTGTTTACCTGGTGGAGAATCCTGGGGGTTATGTGGCGTATAGTAAGGCTGCAACAGTTACTGGTAAACTGGTCCATGCTAATTTTGGTACTAAAAAAGATTTTGAGGATTTATACACTCCTGTGAATGGATCTATAGTGATTGTCAGAGCAGGGAAAATCACCTTTGCAGAAAAGGTTGCAAATGCTGAAAGCTTAAATGCAATTGGTGTGTTGATATACATGGACCAGACTAAATTTCCCATTGTTAACGCAGAACTTTCATTCTTTGGACATGCTCATCTGGGGACAGGTGACCCTTACACACCTGGATTCCCTTCCTTCAATCACACTCAGTTTCCACCATCTCGGTCATCAGGATTGCCTAATATACCTGTCCAGACAATCTCCAGAGCTGCTGCAGAAAAGCTGTTTGGGAATATGGAAGGAGACTGTCCCTCTGACTGGAAAACAGACTCTACATGTAGGATGGTAACCTCAGAAAGCAAGAATGTGAAGCTCACTGTGAGCAATGTGCTGAAAGAGATAAAAATTCTTAACATCTTTGGAGTTATTAAAGGCTTTGTAGAACCAGATCACTATGTTGTAGTTGGGGCCCAGAGAGATGCATGGGGCCCTGGAGCTGCAAAATCCGGTGTAGGCACAGCTCTCCTATTGAAACTTGCCCAGATGTTCTCAGATATGGTCTTAAAAGATGGGTTTCAGCCCAGCAGAAGCATTATCTTTGCCAGTTGGAGTGCTGGAGACTTTGGATCGGTTGGTGCCACTGAATGGCTAGAGGGATACCTTTCGTCCCTGCATTTAAAGGCTTTCACTTATATTAATCTGGATAAAGCGGTTCTTGGTACCAGCAACTTCAAGGTTTCTGCCAGCCCACTGTTGTATACGCTTATTGAGAAAACAATGCAAAATGTGAAGCATCCGGTTACTGGGCAATTTCTATATCAGGACAGCAACTGGGCCAGCAAAGTTGAGAAACTCACTTTAGACAATGCTGCTTTCCCTTTCCTTGCATATTCTGGAATCCCAGCAGTTTCTTTCTGTTTTTGCGAGGACACAGATTATCCTTATTTGGGTACCACCATGGACACCTATAAGGAACTGATTGAGAGGATTCCTGAGTTGAACAAAGTGGCACGAGCAGCTGCAGAGGTCGCTGGTCAGTTCGTGATTAAACTAACCCATGATGTTGAATTGAACCTGGACTATGAGAGGTACAACAGCCAACTGCTTTCATTTGTGAGGGATCTGAACCAATACAGAGCAGACATAAAGGAAATGGGCCTGAGTTTACAGTGGCTGTATTCTGCTCGTGGAGACTTCTTCCGTGCTACTTCCAGACTAACAACAGATTTCGGGAATGCTGAGAAAACAGACAGATTTGTCATGAAGAAACTCAATGATCGTGTCATGAGAGTGGAGTATCACTTCCTCTCTCCCTACGTATCTCCAAAAGAGTCTCCTTTCCGACATGTCTTCTGGGGCTCCGGCTCTCACACGCTGCCAGCTTTACTGGAGAACTTGAAACTGCGTAAACAAAATAACGGTGCTTTTAATGAAACGCTGTTCAGAAACCAGTTGGCTCTAGCTACTTGGACTATTCAGGGAGCTGCAAATGCCCTCTCTGGTGACGTTTGGGACATTGACAATGAGTTTTAAATGTGATACCCATAGCTTCCATGAGAACAGCAGGGTAGTCTGGTTTCTAGACTTGTGCTGATCGTGCTAAATTTTCAGTAGGGCTACAAAACCTGATGTTAAAATTCCATCCCATCATCTTGGTACTACTAGATGTCTTTAGGCAGCAGCTTTTAATACAGGGTAGATAACCTGTACTTCAAGTTAAAGTGAATAACCACTTAAAAAATGTCCATGATGGAATATTCCCCTATCTCTAGAATTTTAAGTGCTTTGTAATGGGAACTGCCTCTTTCCTGTTGTTGTTAATGAAAATGTCAGAAACCAGTTATGTGAATGATCTCTCTGAATCCTAAGGGCTGGTCTCTGCTGAAGGTTGTAAGTGGTCGCTTACTTTGAGTGATCCTCCAACTTCATTTGATGCTAAATAGGAGATACCAGGTTGAAAGACCTTCTCCAAATGAGATCTAAGCCTTTCCATAAGGAATGTAGCTGGTTTCCTCATTCCTGAAAGAAACAGTTAACTTTCAGAAGAGATGGGCTTGTTTTCTTGCCAATGAGGTCTGAAATGGAGGTCCTTCTGCTGGATAAAATGAGGTTCAACTGTTGATTGCAGGAATAAGGCCTTAATATGTTAACCTCAGTGTCATTTATGAAAAGAGGGGACCAGAAGCCAAAGACTTAGTATATTTTCTTTTCCTCTGTCCCTTCCCCCATAAGCCTCCATTTAGTTCTTTGTTATTTTTGTTTCTTCCAAAGCACATTGAAAGAGAACCAGTTTCAGGTGTTTAGTTGCAGACTCAGTTTGTCAGACTTTAAAGAATAATATGCTGCCAAATTTTGGCCAAAGTGTTAATCTTAGGGGAGAGCTTTCTGTCCTTTTGGCACTGAGATATTTATTGTTTATTTATCAGTGACAGAGTTCACTATAAATGGTGTTTTTTTAATAGAATATAATTATCGGAAG