Transcript asmbl_10789

Sequence
Transcript Sequence for observation asmbl_10789 of TGE0003554:
CAGGGACCGCCTACACCTGCGACGGACCACGGAGCAGCACGTGCCGGAGGTGGGCGTCCAGGTGAAGCGGAGGAGGACGGCGTCGCTGAGCAGCCACGAGCCCCGTGCTCTGCCGCCGCTGCCCGCTGCCCGGCTGGCGTTGTCTGTGGCAGGACCTGTGCCGTCCCTGGTCTGTAGCCCTCCCTCAGGTCGGCGGTCCCGAGCTTCACCGCGAACGTCGGATCCGGTGGGCCTGCAATCATGACGGTGGGCAAGAGCAGCAAGATGCTGCAGCACATCGACTACCGCATGCGCTGCATCCTGCAGGACGGCCGCATCTTCATCGGCACCTTCAAGGCCTTCGACAAGCACATGAACTTGATCCTCTGCGACTGCGACGAGTTCCGGAAGATCAAGCCAAAGAACGCGAAGCAGCCGGAGCGTGAAGAGAAGCGGGTTTTGGGTCTGGTGCTGCTCCGAGGGGAGAACCTGGTCTCCATGACGGTGGAGGGGCCGCCCCCCAAAGACACCGGCATCGCTCGTGTGCCCCTCGCCGGAGCTGCAGGAGGCCCTGGAGTTGGCAGGGCCGCGGGCCGAGGAGTGCCAGCCGGCGTCCCCATTCCCCAGGCTCCTGCTGGATTAGCAGGCCCTGTCCGAGGGGTTGGGGGACCGTCCCAGCAGGTGATGACCCCACAGGGACGAGGCACTGTGGCAGCTGCGGCCGTCGCCGCTACCGCCAGCATTGCCGGAGCCCCAACGCAGTACCCACCAGGTCGGGGGACGCCCCCCACCCCTGTGGGCCGAGCCACCCCACCGCCAGGCATCATGGCTCCTCCCCCTGGCATGAGGCCACCTATGGGCCCACCAATCGGCCTTCCCCCGGCCCGTGGGACACCGATAGGCATGCCCCCCCCAGGCATGAGACCCCCGCCACCAGGAATCAGAGGCCCGCCTCCCCCGGGAATGCGCCCCCCGAGGCCCTAGGACGCTGTCGGTCCTCGGTCACCCCCGCAGTGCGTCTCGTGAAACCGTGTAGAGTGTTCGTGAGCCTTTGTTTCCTCTGCCGCCTCCGTGTTCGCCAATAAACGCATAAGCATGTCCA