Transcript asmbl_10673

Sequence
Transcript Sequence for observation asmbl_10673 of TGE0003546:
GCTGAAAGGATCTGTGAGTATCACGCCACCATAAAAGAGGGAAAGTTACCCTATTGGATCTGTTCAGTTGACCAAGCTCATGGCGACATCTGAGCAAAACTTCAGATGAATATTTTCATCCAAAGAAAATAAATTGTCAAGACACGTTCAAAAGCACTTGAGATCTGAAGGTTGTTAGCTTGTGTATATTATGCTTCCAATAAGAAAAAAATACTTGTGTTCTCCGCCTAAAATCGGAGTGTTTGCCATTTGCCACTAAGGAAAATGGTTGCAAACGTTCAGTAAACTGTTCTGGGAATAGCTGGGCTTTTCTGACACTTGACCTGAGAAGTCTTTCTCATCTCCTGTAGAATGAGTCTCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCTATGGAAGCTGCTAACTACCAAGACACTATTGGCCGCCTGCAGGATGAGATTCAGAACATGAAGGAAGAAATGGCTCGTCACCTTCGTGAATACCAAGACCTGCTGAATGTTAAGATGGCTCTTGACATTGAGATTGCCACCTACAGGAAGCTGCTGGAAGGCGAGGAGAGCAGGATTGCTCTGCCTCTTCCAACCTTTTCTTCCCTGAACCTGAGGGAAACCAATCTGGATTCGCTCCCTCTGGTTGACACCCACTCAAAAAGGACACTTCTGATTAAGACGGTTGAAACTAGAGATGGACAGGTTATCAATGAAACTTCTCAGCATCACGATGACCTGGAGTGAAAATTGCACAGAGTTGGTGCAGCAATATTATTACCAGCAACAATAAAAAAGAAATTCATTTCTTAAAGAAACAGCTTTTAAGTGCCTTTCTGCAGTTTTTCAGGAGCGCAAGATAGATTTGAAATAGAAATAAGCTCTAGTTCTTAAGAACCAACACTCCTAAAAGATTTAGAAAAAAGTTTACAACGTAATCTAGTTTATGAAGAAGTCTTGTGCTAGAATACTTTTTAAAAAGTATTTTTGAATACCATTCAAACTGCTTTTTTCCAACAAGTATCTGACCAATGTGTCTCTGCTTCAATAAATCTTTGAAATCTG