Transcript asmbl_10625

Sequence
Transcript Sequence for observation asmbl_10625 of TGE0003534:
GTCGGCTGCGCACGCGCGGTGAGGCCCGACTGGGCGACCTTCAGCGGGGCCGGTAGCACCATGTTTTCTCGGGCGGGCGTCGTTGGGGTCTCGGCCTGGGCCGTGCAGCCGCAATGGATCCAAGTTCGAAATATGGCAACTTTGAAAGATATTACCAGGCGACTAAAGTCAATCAAAAACATCCAGAAAATTACCAAGTCTATGAAAATGGTGGCAGCAGCCAAATATGCCCGAGCTGAGAGGGAGCTGAAACCGGCTCGCGTGTATGGAATAGGATCTTTGGCTCTTTATGAAAAAGCTGACATTAAGGGGCCCGAAGACAAGAAGAAACACCTCCTGATCGGAGTGTCCTCGGACAGAGGCCTTTGTGGTGCCATCCACTCCTCTGTCGCTAAGCAGATGAAAAACGAGGTGGCTACACTCACGGCGGCCGGGAAGGAAGTTAAGATTGTTGGAGTTGGCGATAAAATTAGGGGTATACTTCATAGGACTCACTCTGACCAGTTTCTGGTGACATTCAAAGAAGTGGGAAGAAAACCTCCCACTTTTGGAGACGCGTCGGTCATCGCCCTGGAATTACTAAACTCTGGCTATGAGTTTGATGAGGGGTCTATCATCTTTAATCAGTTCAGGTCTGTCATCTCCTACAAAACAGAAGAAAAGCCCATCTTTTCCCTCAATACCATTGCGAGTGCTGAGAGCATGAGCATCTACGACGACATTGATGCCGACGTGCTGCAGAATTACCAGGAGTACAGTCTGGCCAACATCATCTACTACTCTCTCAAGGAGTCCACTACGAGCGAGCAGAGCGCCAGGATGACGGCCATGGACAACGCCAGCAAGAACGCTTCTGAGATGATTGACAAGTTGACTTTGACTTTCAATCGCACGCGTCAAGCTGTCATCACAAAGGAGTTGATCGAAATCATCTCTGGTGCTGCGGCTCTGTAAGTAACTGCAGATGGCCTGCGGAGAGTTGGTTCTCATCTCTGTGTCTGCTGGTTTAAGCTTGGGATGTTTGAAAGTTTTTGCGTGTGTTTTGTCTGTTAAAG