Transcript asmbl_10617

Sequence
Transcript Sequence for observation asmbl_10617 of TGE0003531:
GCGGTAAACTGGAAAGATGTCCCTGTATGATGACCTGGGAGTGGAGACCAGCGACTCGAAGACGGAAGGCTGGTCCAAGAACTTCAAGCTGCTGCAGTCTCAGCTTCAGGTGAAGAAGGCGGCCCTCACCCAGGCGAAGAGCCAGAGGACAAAACAAAGCACAGTCCTCGCCCCGGTAATCGACCTAAAGCGAGGCGGCTCTTCAGACGACCGGCAGGTCGTGGACACCCCGCCGCACGTAGCCGCCGGCCTCAAGGATCCTGTACCCAGTGGATTTTCCGCGGGAGAAGTTCTGATTCCCTTAGCCGACGAATACGACCCTATGTTCCCTAACGATTATGAGAAAGTCGTGAAACGCCAGAGAGAGGAGCGACAGAGACAGCGAGAGCTGGAAAGACAGAAAGAAATAGAAGAGAGAGAAAAGAGGCGTAAAGACCGACACGAGGCCAGTGGGTTTTCAAGGCGACCAGACCCAGATTCTGATGAAGATGAAGATTACGAGCGAGAGAGGAGGAAAAGAAGTATGGGCGGAGCCGCCATCGCCCCACCCACCTCTCTCGTGGAGAAAGACAAAGAGTTACCCCGAGAATTTCCTTACGAAGAGGACTCCCGACCGCGCTCACAGTCTTCCAAAGCCGCCGTTCCTCCGCCGGTGTACGAGGAGCAGGACAGGCCCCGGTCCCCAACGGGGCCTGGCAACTCCTTCCTCGCCAACATGGGGGGCACGGTCGCTCATAAAATCATGCAGAAGTACGGCTTCCGGGAAGGCCAGGGGCTCGGGAAGCACGAGCAAGGGCTGAGCACGGCGTTGTCGGTGGAGAAGACGAGCAAGCGAGGAGGCAAGATCATTGTGGGCGAAGTCACAGAGAAAGATGCATCCAAGAAGTCGGATTCAAATCCACTAACTGAAATACTTAAGTGTCCTACTAAAGTGGTCCTACTAAGGAACATGGTTGGTGCAGGAGAGGTAGATGAAGACTTGGAGGTTGAAACCAAGGAAGAGTGTGAAAAATATGGCAAAGTTGGAAAATGTGTGATATTCGAAATCCCTGGTGCCCCTGACGATGAAGCAGTGCGGATATTTTTAGAATTCGAGAGGGTCGAATCAGCAATTAAAGCTGTCGTAGATCTGAATGGGAGGTATTTCGGTGGCCGGGTGGTAAAAGCATGTTTCTACAATTTGGATAAGTTCAGAGTCTTGGATTTGGCGGAACAAGTTTGATTTTAAGAACTGGAGCACGAACCACAAGCTCCAAGCCGAGCAGAGGAGGCGACAGCCAGCTCGCGTGCTGTGTGCGCAGGGACTCAGAAGGGCTGCTGAGATGTGTGTTGATTGGTCCCTTTTTTTTTATTTTGTGTTTTTTTAATATAGCATAAAAATCCTTAAAAAAAAA