Transcript asmbl_10344

Sequence
Transcript Sequence for observation asmbl_10344 of TGE0003530:
GCCGCCGCGACCGTCTCGCCGGCGCTCCGCGGGTAAGCGCTCCTGCCCGAGCCTCGCGGGATCAGCTTTTCCCTGGTTGCGGGCGTTTCCGTACTGTCGCCCCCTTCACCTTGGATCATGTTCAAGAAATTCGACGAGAAGGAAAACGTGTCCAACTGCATCCAGCTGAAAACGTCCGTTATTAAGGGCATTAAGAACCAGTTGACAGAGCAGTTTCCAGGCATCGAACCGTGGCTTAACCAAATCATGCCCAAGAAAGACCCCGTCAAAATAGTGCGGTGCCACGAGCACATAGAGATCCTCACGGTCAACGGGGAGCTGCTGTTTTTTAGACAAAGAGAAGGGCCTTTTTACCCGACGCTGAGGCTGCTCCACAAGTACCCGTTTATCCTGCCGCGCCAGCAGGTGGATAAAGGAGCCATCAAATTTGTCCTCAGTGGCGCGAACATCATGTGTCCAGGCCTGACGTCTCCCGGGGCCAAGCTGTACCCTGCCGCGGTGGATACGGTGGTGGCCATCATGGCGGAAGGAAAACAGCACGCCCTGTGTGTCGGAGTCATGAAGATGTCTGCGGAAGACATCGAGAAAGTCAACAAGGGGATCGGCATCGAAAATATCCATTATCTAAACGACGGACTGTGGCACATGAAGACGTATAAATGAGCCGCAGAAGGAGTGCGCCTGCGCCGATATGGACATTGTGCTGTGGCTGTGTTTGTGTCTGTGTGGCGGTATGAAGACGGTACCTCTGTGGTTACGTCGAATAAATTCAATGGATGCT