Transcript asmbl_10277

Sequence
Transcript Sequence for observation asmbl_10277 of TGE0003521:
GGTGGATCTGTAGAGAGACCAGCTGACTAGGAGAGGGAGGGGAGGAGCCCAGCTGTGAGGTGTGTGAGCCTAAGAACCATGTCTACGCGGGAGTCCTTTAACCCAGAAAGTTATGAATTGGACAAGAGCTTCCGGCTAACCAGATTCACTGAACTGAAGGGCACTGGCTGCAAAGTGCCCCAAGATGTCCTGCAGAAATTGCTGGAATCCTTACAAGAGAACCACTTCCAAGAAGATGAACAGTTTCTGGGAGCAGTTATGCCAAGGCTTGGCATTGGGATGGATACTTGTGTCATTCCTTTGAGGCATGGTGGTCTTTCCTTGGTTCAAACCACAGATTACATTTATCCTATCGTCGATGACCCTTACATGATGGGCAGGATAGCATGTGCCAATGTTCTCAGTGACCTCTATGCAATGGGGGTCACAGAATGTGACAATATGCTGATGCTCCTTGGAATCAGTAATAAAATGACCGACAGGGAAAGGGATAAAGTGATGCCCCTAATTATACAGGGTTTTAAAGATGCAGCAGAGGAGGCAGGAACGTCTGTAACGGGCGGCCAAACAGTGTTAAACCCCTGGATTGTTTTGGGAGGAGTGGCTACAACTGTCTGCCAGCCCAATGAATTCATCATGCCAGATAACGCAGTGCCTGGGGACGTGCTAGTGCTGACGAAGCCCCTGGGGACGCAAGTGGCCGTGGCCGTGCACCAATGGCTGGATATTCCTGAAAAATGGAATAAAATTAAATTAGTGGTGACCCAAGAAGACGTGGAGTTGGCATACCAGGAGGCCATGATGAACATGGCAAGGCTCAACAGGACAGCTGCGGGACTCATGCACACGTTCAACGCCCACGCCGCCACCGACATCACGGGCTTCGGGATTCTGGGCCACGCGCAGAACCTGGCCAAACAGCAGAGGAACGAGGTTTCCTTCGTGATTCACAACCTCCCCGTCCTGGCCAAGATGGCTGCTGTGAGCAAGGCCTGTGGGAACATGTTTGGCCTCATGCATGGGACCTGCCCCGAGACATCAGGTACAAGGATCCTGGGCCCAAATCCGAGGATTAACTAGTGAGGCTAATGGAAAGT