Transcript asmbl_9699

Sequence
Transcript Sequence for observation asmbl_9699 of TGE0007905:
AGCAACAGCAGCAGCAGCAGCAGCCTCGCCCTCCTCCTCGCCAGCAGGAAAGAGCCCACTTGGAGAGTCTGGGGCTCAGTAGGCCTAGTCCCCAGCTGTTGGCAGAAACCCCTGTGCCTGGCCTCCCTGAGTTCCCACGGGCAGCCTCCCAGCAGGAGATCGAGCAGTCCATCGAAACCCTCAACATGCTGATGCTGGACCTGGAGCCAGCTGCGGCTGCCGCCCCCCTGCACAAATCCCAGAGTGTCCCAGGGGCCTGGCCAGGGGCCTCCCCGCTCTCTTCCCAGCCCTTCTCCGGCTCCTCCTGCCAGTCCCATCCGCTGACCCAGTCCAGATCTGGCTACATCCCCAGTGGGCATTCCTTGGGAACCCCTGAGCCAGCTCCACAGGCCTCCCTGGAGTCCGTCCCTCCTGGCAGGCCTTACTCACCTTATGATTATCAGCCATGTCCGGCTGGGCCCAACCAGAGCTACCGTCCAAAGAGCCCAGCTTCCTCCTCCACGTCCTCTGCCTTCCTTCCAACCACTCACAGCCCTTCAGGGCCTCAGCAGCCTCCGGCATCTCTCCCTGGCCTCACCGCTCAGCCTCAGCTCTCACCAAAGGAAGCGACTTCAGATCCATCCCGAACTCCGGAGGAGGAACCCTTGAACTTGGAGGGGCTAGTGGCCCACCGGGTAGCAGGGGTGCAGGCTCGGGAGAAGCAGCCTGCAGAGCCCCCGGCCCCTCTCCGGAGGCGGGCGGCCAGTGATGGACAGTATGAGAACCAGTCTTCAGAACCCTCATCTCCCCGGAGCCCTGGGGTTCGCTCCCCTGTCCAGTGCGTCTCCCCAGAGCTGGCTCTCACCATCGCTCTTAATCCTGGAGGACGGCCCAAAGAGCCCCATCTGCACAGCTACAAGGAGGCTTTTGAGGAGATGGAGGGAACCTCTCCGACCAGCCCACCGCCCAGTGGGGTGCGCTCCCCTCCAGGTCTGGCCAAGACACCCCTGTCTGCTCTGGGCCTGAAACCCCACAACCCAGCGGACATCCTGTTGCACCCCACAGGTGAGCCTCGGAGCTACGTCGAGTCGGTGGTGCGGACGGCAGTAGCTGGGCCCCGAGCTCAGGACCCTGAGCCCAAGAGCTTTAGCGCCCCAGCTGCCCAGGCCTATGGCCATGAGACGCCCCTGAGGAATGGGACCCTGGGTGGCTCCTTTGTCTCCCCCAGCCCCCTCTCCACCAGCAGCCCCATCCTCAGCGCTGACAGCACTTCAGTGGGGAGTTTCCCGTCAGGAGAGAGCAGTGACCAGGGCCCCCGGACACCCACCCAGCCTTTGCTGGATTCCGGCTTCCGCTCCGGCAGCCTGAGCCAGCCCAGCCCTTCGGCTCAGAGAAGCTACCAGAGTTCTTCTCCTCTCCCGGCCGTGGGCAGCAGCTACAGCAGCCACGACTACTCACTGCAGCAGTTCAACTCCCCAGAAAGCCAGGCCCGGGCTCAGTTTGCTGTGCCCAGCGTCCACACGGTACCCGGGAGCCCTCAGGCACGCCAGAGGACAGTGGGCACCAATACTCCCCCTAGCCCTGGCTTTGGTCGCCGAGCCATCAACCCCAGCATGGCTGCCCCTGGCAGCCCCAGTTTGAGCCACCGCCAGGTGATGGGCCCATCAGGAGCTGGTTTCCATGGTAACACAGTTTCCAGCCCCCAGAGCAGTGCAGCGACCACTCCAGGAAGCCCCAGCCGGGGCCAGCACCCTGGGGCCCACCAGGCCTCAGGCCTCCATGGCAGTGTGGTCACCACTCCAGGGAGCCCAAGCCTGGGCCGGCACCCAGGAACCCACCAGGGCAACCTGGCCCCCAGTCTCCATGGCAACACAATAGCCAGCCCCGGAAGCCCCAGCCTGGGCCGGCACCTGGGAGGATCTGGATCTGTGGTTCCCGGAAGCCCCAGCTTAGACCGGCACGTGGCCTATGGCGGCTACTCCACCCCTGAGGACCGGAGACCCACGCTGTCCCGGCAGAGCAGTGCCTCCGGCTACCAGGCTCCCTCCACGCCCTCCTTCCCTGTGTCCTCTGCCTACTACCCTGGTCTGAGTAGCCCTGCCACCTCCCCCTCGCCGGATTCAGCAGCCTTCCGGCAAGGGAGCCCAACACCGGCCTTGCCAGAGAAGCGGAGGATGTCCATGGGAGACCGGGCGGGCAGCCTCCCCAACTATGCTACCATCAACGGGAAGGTGTCCTCCTCGCCTGTCGCCAGCGGCATGTCCAGTCCCAGTGGGAGCAGCACCGTCTCCTTCTCTCATACTCTGCCTGACTTCTCCAAGTACTCCATGCCAGACAACAGCCCTGAGACCCGGGCTAAAGTGAAATTTGTCCAGGACACTTCCAAGTATTGGTACAAGCCTGAGATCTCTAGAGAGCAGGCCATCGCACTCCTGAAGGACCAGGAACCAGGGGCCTTCATCATCCGTGACAGTCACTCCTTCCGAGGGGCCTATGGGCTGGCCATGAAGGTGTCATCTCCCCCTCCGACCATTATGCAGCAGAATAAAAAAGGGGACATGACCCATGAGCTGGTGAGACATTTCCTGATAGAGACTGGCCCTAGAGGAGTCAAGCTCAAGGGGTGCCCCAATGAGCCAAACTTTGGATCCCTCTCTGCCCTGGTCTACCAGCACTCCATCATCCCACTGGCTCTGCCCTGCAAGCTGGTCATTCCAAACCGAGATCCCACAGATGAATCGAAAGATAGCTCAGGCCCTGCCAACTCAACCACTGACCTGTTGAAGCAAGGGGCAGCCTGTAACGTGCTCTTCGTCAACTCTGTGGATATGGAGTCACTCACTGGGCCACAGGCCATCTCCAAAGCCACTTCTGAGACACTGGCTGCTGACCCCACGCCGGCTGCCACCATTGTTCACTTCAAAGTTTCTGCCCAGGGAATTACACTGACTGACAACCAGAGGAAGCTCTTCTTCAGACGACACTACCCCCTCAACACTGTCACTTTCTGTGACCTGGATCCACAGGAGAGAAAGTGGATGAAGACGGAGGGAGGGGCCCCTGCTAAGCTCTTCGGCTTTGTGGCCCGGAAGCAGGGCAGCACCACGGACAACGCCTGCCACCTCTTCGCTGAGCTTGACCCTAACCAGCCTGCTTCCGCCATTGTCAACTTTGTCTCCAAGGTCATGCTGAGTGCTGGCCAGAAGAGATGAACCCACCCCTTGCCTGGGGCCAGGGCAGTGGGGATGGGGCATGTGGGGGCGGGGAGACCCATGAATCCTGACCACCTTTAAATCCAGAAGGAGGACTTTGGGCTAATTTTGGAGAAGGAGAGAAGAAAGTGCAATGTGGGGAGAGGGAAGTGAATCGCAGAGGGGAGGGGGAGAGCGGGAGAGAAAGAAAGAAAAAGATGGAGGAGGATTACTGGGATTCCTTTGGTTAGATGGATACTACGTAACCCCAAAGCCTCCCAAACTAACCAGGTCCACCTAACTCTCCCTCACCCTCCCAGAAGACAGAGTTTCTCAAAGGAGGCAGAACGGACCTCCTTGGGGATCCATGTTTTGAGGGGAATGGAAAAGCTCTGTCTCCCTAGCCCTGCTTTGCAAGGAGAAATCAAGTTGAGAGAATCTTTTTCCGGCGATCTCTAGGGTAGATTGCCAAACCAAAAAGAGCCAGCATGGGACGTCAAGGGGCAGGACTTTTGTTTTTGAAGGTAACTCAGACCCGAGGCACCTAAGGTCTCTTTGCTCTGTCTCCGATGTATAGTTCATGTGGGTATATATGTAGGGTGTGTATATGTCCACACCCACATCCTCACACACTGATTTATATTTGCCTCTCAGCTCGCATTATAAACAGGTGTACTTGTCCGTGTCCATGCGTTTGCACACACGTGCATATCGTCCAAAGAAGGTTAGAGTTGGGGTGACACAGCAGAGGAAGGGGACATCAGCCCTTCTCCCCAGGAGCACCCAGGAATATGGGTAACAGACTCTGTCTCGGTCCCTGCACCTGCAGCCTAGTAGCCCTGGGTGCCAGCAGGAGCGGGGCCGGCCACCTGCAGCATCCCTGTTCTGCCTTGGCCAGGAGGCAGGAGCACTGATGTGAGGAGATGGGGGACACGAATGCCCATCGCCTTGGGGAAGAGATCCGTCAGCCGTGGTGGCTGCAGAGCTCCGGGCATCTCTCCTGAGGCGTGTGGCCCAGCGGTGAGGTGGCTGGGTCGCTCCTGCCAGTCCCAGGCCTCAGCCCGTCCTTGGGTGCCCCGCCCAGACCAGCCTTATCTCAGACTTGCTTATCTGCATGGTGTCTTATTGGGTGCTGGAGATTGAGCCTTCCTGCTCTGCCCTGCCCTGCTCTGTCCTGCAGGGTCCCCGTGTTGGGCTCATCCAGGGGATCCTGCTTCTAAGAGTCCTGCTCAGCGAGGCCCGGGGGAGACTCCTGTCGTCCTTGTACCCCCGTCTGCAAGTGTTTTGGGGCCCGACTTTTGCTGGGCTGTCCAGGTGACTTAGTAGAGCTCTGGGGGCTGCTACCTGTACACCACATGGCCTACCTACAATACCAAAGCCTTGCTGTTCCCCCTTCTGCCTTGGTTTCCCCAGCAGAGCCAAGCTGCTCGTGAGTGGAGGGCAGAAGGCACACATTTAGGCCAAAGGGCAGTTGGGAACCCCTCAACCTCCACCCAAGGACTCTAAGCTGGAATGGAAAGTCTACCAGGATTCCATTCTTGAGGGGTTTCTTAAGCCTCTGGGGGTCCCCTAGAGAGAGGCATTGTATTGATATATAAATATATATAATATATATGTGAGACATACTGACAGAATCTGTAAGCTAATAAAATATAAGAAAAGGTTAAAAAAAGAATAGGTAAATTGACAAGAAGTATTTATTATTTTCCCATATTGCTTTATTGCCTCCCTGGGCGTAAACCAATTCCCATCCCTCTTGATATGTTTAAGTGAAGCCTGAAATGTGGGGACCTTTTTCTTTGGAGCAATCAGGGGTCTCCTTGCCCTGGCCTTGACCTTCCCCAGACTCTGTCTGGGGCTCAGCGGGGAGGGGTGCACGTGTTCCACCCCCTTTGGCCCCCTTATTTTCTGGCAAGCCCAGGACTCAGCCATCAGCTCCCGAGATGAGAAGAGAGCTGTCTGCTTACTGCGGCTCCGGCCCCAGCGGGCCGGCGGGGGACATGCGTGTTTGTGGCTGGCTTGGGCAATGTGTGCATCTTTTGTATTTTTTTCTCCTCCGAGAAGCTGTGTCTGTGTGGGCCTTCTGTTTCAGGAGAGTGTCTATAGAGTGTCTAAAGTGGGGGCAGCCCCCACTTCCCAAAGATTGAAACCTTGTGCTTGGTGACCAGGCTCCTCCACAGTGCTCTTCCTTCTGAGGGCGTTCAAGCCAGATATCCGGAATTCCCTCTCCTCAGTCCCTCCTACCCCGACTCTCTTCCCAGGTGGGAGATATCCTGCCTCCTCCCTTTGTACATATCTTACCCTCCCACGGGACAGCCCGGGGACACTCTCCTGGTCTGGATGTCCTCGCCACACTTGAGGCCGGGTGGCGTGTGAGACCGTTCTGCGGACCCAGGCCTGGGGTCAGCCTTCTCACGTGCTTTCCCACTGCCCACCACGGCCCATCTCCCAGGCACGGCCAGAGCACCCCACCCAGGCCTGAGCTGAGTGTGACCCTTGGGGTGCCAGGAAGCTGATCGACTCACTCCCTGCTGTTGCTTTGGAAGGAGTCGATTTCCTGGAGCTTGGCCTTTCCGGAAGAATGATGGGGAAGGGCACCTCAGTCTCCACGGTAGCCCCCCACTTTGGGTCAGACACTGGTTGGGAAGACACTGTAGCCCTCCCATGTCTCACAGGTTAGGCCTGTGCACCCATGCGTGCACACACACACACACACACAC