Transcript asmbl_8850

Sequence
Transcript Sequence for observation asmbl_8850 of TGE0002306:
CCGCTCTGCTGCGGTCGGTTCCTGCGTCCGCTGCTGCCGGTTCCGCCACGCTGCAGGTATTTTTTCCTGAACAAAAGCTGCCTCAACCTATGTTTCAAGGATGGCTCTCCCTATCATTGTAAAATGGGGTGGACAGGAATATTCAGTGACCACACTTTCAGAAGATGATACTGTGCTAGATCTCAAACAGTTTCTCAAGACGCTCACAGGAGTGCTACCAGAACGCCAAAAGTTGCTTGGACTTAAAGTTAAAGGCAAACCTGCAGAAAATGATGTTAAGCTTGGAGCTCTCAAACTGAAACCAAATACTAAAATCATGATGATGGGAACTCGTGAGGAGAGCTTGGAGGATGTCTTAGGTCCACCTCCTGACAATGATGATGTTGTCAATGACTTTGATATTGAAGATGAAGTAGTTGAAGTAGAAAATAGGGAAGAAAACCTACTAAAAATTTCTCGCAGAGTAAAAGAGTACAAAGTGGAAATTTTGAATCCTCCCAGGGAAGGGAAAAAGCTTTTAGTACTTGATGTGGATTATACATTATTTGACCATAGGTCTTGTGCAGAGACTGGCGTAGAATTAATGCGGCCATATCTTCATGAATTCCTAACATCTGCATATGAGGATTATGACATTGTTATTTGGTCTGCAACAAATATGAAGTGGATTGAAGCTAAAATGAAAGAGCTGGGAGTGAGCACAAATGCAAATTATAAAATTACCTTCATGTTGGACAGTGCTGCTATGATAACAGTGCATACACCAAGGAGAGGATTAATAGATGTAAAGCCTCTTGGTGTTATATGGGGAAAGTTTTCGGAATTTTACAGCAAAAAAAACACCATTATGTTTGATGACATAGGAAGAAATTTTCTAATGAACCCACAGAATGGACTAAAGATAAGGCCTTTTATGAAAGCGCATCTAAATCGAGATAAAGACAAAGAACTTTTAAAATTAACTCAGTACCTCAAGGAAATAGCAAAATTGGATGACTTTTTGGACCTAAATCACAAATATTGGGAAAGGTATCTCTCAAAGAAGCAAGGACAGTAGTTACAAGTTATACTGGCAGTTATTGAAGATACTTGAGATCCATGAACTTCTTGCTTTAATGCTAGAAATCATTATAATAGTGCTGGACACTGAAGCAAATACCAGACTGCTTATACTTGGTCTTCCAGTTTTTTGTAAATTTAATTTTATATTTTTTGAAGCTCATGGCAATATGCTAAAAAACAAAAACAAACAAACAAAAAACCCTTTTTTCCCCGGTAAGAATATACTGTTACTCTTGAAAAATATTTTCTCCAGCATTGAGTACTGAGTTTTTTTTCCCACATACACAAAAAAAAGTGGACAAAAATGTATATTCAACAATGTCATTTTGTGACTTTGGAAACAAGTTATGTCTTGTGTTTTTGCCTCCTTGTGGTGTTTGACTAAATCTTAGACCAAACCCATCTTGAAAACTACTGCTCTTCCTTTTAAAACCAAAAAATATCTTTTGAGTAAGGAACCTAGTTTGGTGTTTAAGTTAAAGTCACCAAGAGTTTTTTTCATTCCTTTGTCATAGACACAGTTTCTCTTCTTGCTCCACTATTTACATATCTAAATTCTGAGCTGTCTCAGTTTGGTCTGTATGTGTATCCATGTTCTTTGAGTAAAACTGGAAAATGTCAGCCGTGATACAGATATGTCATAGTATGAAAATTAGAAAACAAGACTGAAGAATAAAATTAAGGAACGAGAGTTTCTTTTTGGTGACTAAGTAGAAGCACTTCTGCCTAAAACCATTGTCATAAAAGCAGTTAAAGGCAATACATTTTTAAATGGGACAAATCATCGATTAAGCCCTAGAAAGCATGAACAAAAAGGTTTTGTTCTGTTCCAGCTATACCTTGTCTAAGTGCAAACACTGTTTCAGTGGAAATATCTAGCCATAAGCTTTAAAAAATTATTTGCAATGCTTAAGCCTGCAGATGTGTAATGTGGCCACTGTTTTGTGTTAACAGTATTGCTTTATACAGTTCTTGTATTTGAAAGGAATCTGATCCTTTCACAGGAACATGGTATATATCGTTCTTACGGGACTATTTCAGTGGTGTAAATAATAAATACCTTTTCTTAAAATA