Transcript asmbl_38518

Sequence
Transcript Sequence for observation asmbl_38518 of TGE0001771:
CGAGAATCGGCTCCCGGAAGTTCCACGTCAGTCAGTCTGACGGTCAGTGGATCGGTGGGTTTATCTCAAGGCCTGAGTAGCCGGTAACAAACGAGGGTTCCCGGGATTGGACCGACGCAGCCATGCCTCTGCGACTTGATATCAAAAGAAAGCTAACTGCTAGATCTGATCGAGTTAAGAGTGTGGATCTGCATCCTACAGAGCCATGGATGTTGGCAAGTCTTTACAATGGCAGTGTGTGTGTTTGGAATCATGAAACACAGACACTGGTGAAGACATTTGAAGTATGTGATCTTCCTGTTCGAGCTGCAAAGTTTGTTGCAAGGAAGAATTGGGTTGTGACAGGAGCGGATGACATGCAGATTAGAGTGTTCAATTACAATACTCTGGAGAGAGTTCATATGTTTGAAGCACACTCAGACTACATTCGCTGTATTGCTGTTCATCCAACCCAGCCTTTCATTCTAACTAGCAGTGATGACATGCTTATTAAGCTCTGGGACTGGGATAAAAAATGGTCTTGCTCACAAGTGTTTGAAGGACACACCCATTATGTTATGCAGATTGTGATCAACCCCAAAGATAACAATCAGTTTGCCAGTGCCTCTTTGGACAGGACTATCAAGGTGTGGCAGTTGGGCTCTTCGTCACCAAACTTCACTTTGGAAGGACATGAGAAAGGCGTGAATTGCATTGATTACTACAGTGGTGGGGACAAGCCATACCTCATTTCAGGTGCAGATGACCGTCTTGTTAAAATATGGGATTATCAGAATAAAACATGTGTGCAGACACTGGAAGGACATGCCCAAAATGTGTCTTGTGCCAGCTTTCATCCTGAGTTGCCAATCATTATCACAGGTTCAGAAGATGGAACAGTACGTATTTGGCATTCAAGCACCTACCGGCTTGAGAGCACACTGAATTATGGAATGGAGAGGGTATGGTGCGTGGCCAGTCTAAGAGGGTCAAACAATGTCGCTTTGGGCTATGATGAAGGGAGCATCATTGTTAAGCTTGGTCGGGAGGAACCTGCCATGTCCATGGATGCCAATGGAAAGATAATTTGGGCCAAGCATTCAGAAGTCCAGCAGGCCAACCTAAAAGCAATGGGAGATGCTGAAATTAAAGATGGTGAAAGATTGCCACTGGCAGTAAAGGATATGGGCAGTTGTGAAATATACCCTCAGACTATTCAGCACAATCCTAATGGGCGGTTTGTGGTGGTGTGTGGTGATGGGGAGTATATCATCTACACAGCAATGGCATTGAGAAACAAGAGCTTTGGATCTGCTCAGGAGTTTGCATGGGCCCACGATTCTTCAGAGTATGCAATAAGAGAGAGCAACAGCATTGTAAAGATATTTAAGAACTTTAAGGAAAAAAAATCATTTAAACCAGATTTTGGAGCAGAAAGTATCTACGGCGGCTTCTTATTGGGAGTCAGATCTGTAAATGGCTTAGCCTTCTATGACTGGGACAATACAGAACTCATACGAAGAATTGAAATTCAGCCCAAACATATTTTCTGGTCTGACTCTGGAGAGCTAGTCTGTATTGCTACTGAGGAATCATTTTTTATCCTTAAGTATCTGTCAGAAAAAGTCTTGGCTGCACAGGAAACACATGAGGGAGTTACTGAAGATGGCATTGAAGATGCCTTTGAGGTTCTTGGTGAGATTCAGGAAATTGTGAAAACAGGGCTTTGGGTAGGCGATTGCTTCATTTACACAAGTTCTGTGAACAGATTAAATTATTATGTTGGAGGAGAAATAGTCACCATTGCCCACTTGGACAGGACGATGTATCTCCTAGGCTACATTCCTAAAGACAACAGGCTTTATCTGGGGGATAAAGAATTGAACATCATTAGCTATTCCCTGCTGGTTTCAGTCCTGGAATACCAGACAGCTGTCATGCGGAGGGACTTTAGCATGGCTGATAAGGTCCTTCCTACCATTCCAAAAGAACAGAGGACCAGAGTTGCACACTTTTTGGAAAAGCAGGGCTTCAAGCAGCAAGCTCTTACAGTATCCACAGATCCTGAGCATCGTTTTGAGCTTGCTCTTCAGCTTGGAGAGTTAAAAATTGCATACCAGTTAGCAGTGGAAGCAGAGTCAGAACAGAAGTGGAAACAACTTGCTGAACTTGCCATTAGTAAATGTCAGTTTGGCCTAGCCCAGGAGTGCCTGCATCATGCACAGGATTATGGGGGCCTGCTGCTTTTGGCCACTGCCTCTGGAAATGCTAATATGGTGAACAAGCTAGCAGAGGGTGCGGAGAGAGATGGCAAAAATAATGTGGCATTCATGAGCTACTTTTTACAGGGCAAGGTTGATGCCTGCCTAGAGCTCTTAATTAGAACTGGACGGCTGCCAGAAGCTGCCTTCTTGGCCCGAACTTACTTACCCAGTCAGGTTTCAAGGGTAGTGAAACTCTGGAGAGAGAATCTCTCAAAAGTCAATCAGAAAGCAGCAGAATCCCTTGCTGACCCAACAGAGTATGAAAACCTGTTCCCTGGATTAAAAGAAGCCTTTGTTGTTGAAGAATGGGTGAAGGAAACACATGCTGATCTGTGGCCAGCCAAACAATACCCACTTGTCACGCCAAATGAAGAGAGAAATGTCATGGAAGAGGGAAAAGACTTTCAGCCCTCAAGATCTACAGCTCAACAGGAACTTGATGGGAAACCTGCTTCTCCTACTCCGGTTATTGTGGCCTCCCACACAGCCAACAAAGAAGAAAAGAGTTTACTCGAACTAGAAGTAGATTTGGATAATTTGGAATTAGAAGATATTGACACAACAGATATCAATCTGGATGAAGATATTTTGGATGATTGACTGTAATGCTTTCCATTTACCTGACTAAACAGATCATTATTATATATAGGTATTGATTGCTACCCTGACCACAGTGCTTTGGACTATGAGAAACTTCTTAGATTTTTATATGTAAATGCTGTGGACCACTGGGAGCACAATGCCCACATCATCTTAAGAAGAGTTTATGTGCAGCATTTAAATCACTGTGTTTTCCTTGTTAACTAAAACAGACATGGGCTTTGATTTTTTTCATACTATTAGACCATATCTCATAAAACCTTTTGAATTAATGAAGGTACTTGTTTCCTTTCTCAATAATGAAAATAGGCTTCTAGTTTTAGAAGGCTGAGCCGAAACTACACCTTGCCTAGGGATCAGCCCCACTGTCTTTTCTTTGTATAACTAAATCTGCATTTTCAAATGTTGTCAATCACATTTTTCTTAGAGCTGAATATCCAGGCTGTAATTCTCTAAACCCTTTTTCTTGACCTCATTGCATCATTCCACAGGTCTTGCCCCGATTTTGTCTAGCAGCTACCCATTTCTGGAGTCAGGATGTGAAACCTCTGTTCCTCTGACCTCATTAAGCTGGGGGTCTGTCTAAGTTAACGTTTGCCCTATTTGGTAACACAAAAACACACCAGACTTTTTAACCGTACGCTCATCTAACATGATTTGAGAAATTCATAACCAGGCACTCAAATATCCTTGTAGCCTACGAAAAGTGAGTAGGGTAATAATTTTTGCTTTGTAGGGAGAACTACAAATTGATATCTTTTAATCTGGCCATTTTTTAACATTTAGCTCAATATTAACAGAGAAATGTAGTCA