Transcript asmbl_8617

Sequence
Transcript Sequence for observation asmbl_8617 of TGE0014538:
GGATCCGGTTCCGCCCTCCCTCTTGCTGCCGACCCTCCGGGGCTAGCGCCCGAGTTCCCTTTCCCAGAGTCCTCTGCGCCGTGAAGAAGCGGCTCCCGGGGACCGGGGGCATTTTGCGTTGGCTGGAGCCGGAGTAACAAGATGGCGGCGTCGGCGGAGTGACAGGGGTCCCTCCGGGAGGGAGCCGGCAGCAGTGGTGGCAGCGGGATCGCCGCCCTAACTCACCGCGCCCCTTTTCCAGCCCGCGACGTCGCCGCGAAAGCGAGGCAGCAGCGGCCGCCCAGACACAAGTGGCCCAGCCTGGTAACCGCGAGGACCCCTCACACACTGCGGCCTGGCGAGAAGAAACCTGCCTGAGCGGCGGTGATCAGGTTCCCCTCGGCTGATTCCGGGCCTGGTAACGCCGAGCCAACGCTTTCAGCTTCCTGCCGCCCTCCTCCGCAGCCTTGCTCCGGGGACGAGCCCAGAGGCCTCCGTCCTCCTCTCAGAGGTGTCGGGGCTCGGCCCCAGCCCCCGTCTGCGCCTCTCAGGATGGCGAGCAGCAGCGGCTCCAAAGCCGAATTCATTGTCGGAGGGAAATATAAACTGGTACGGAAGATCGGGTCTGGCTCCTTCGGGGACATTTACCTGGCGATCAACATCACCAATGGCGAGGAAGTGGCAGTGAAGCTAGAATCTCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAGAGCAAACTCTATAAAATTCTTCAGGGTGGGGTTGGCATCCCCCACATACGGTGGTATGGTCAGGAAAAAGACTACAATGTGCTAGTCATGGATCTTCTTGGACCCAGCCTTGAAGACCTCTTCAATTTCTGTTCGAGAAGGTTCACAATGAAAACTGTACTTATGTTAGCTGACCAGATGATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAACCAGATAACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTTATTCCTTATTGATTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACAAGGCAACACATACCATACAGAGAAGATAAAAATCTCACTGGCACTGCCCGATATGCTAGCATCAATGCACATCTTGGTATTGAACAGAGTCGCCGAGATGACATGGAATCATTAGGATATGTTTTGATGTATTTTAATAGAACCAGCCTGCCATGGCAAGGACTAAAGGCTGCAACAAAGAAACAAAAATATGAAAAGATTAGTGAAAAGAAGATGTCCACTCCTGTTGAAGTTTTATGTAAGGGGTTTCCTGCAGAATTTGCCATGTACTTAAACTATTGTCGTGGGCTGCGCTTTGAGGAAGCCCCGGATTACATGTATCTGAGGCAGCTATTCCGCATTCTTTTCAGGACCCTGAACCACCAATATGACTACACATTTGATTGGACAATGTTAAAGCAGAAAGCAGCACAGCAGGCAGCCTCTTCAAGTGGGCAGGGTCAGCAGGCCCAAACCCCCACAGGCAAGCAAACTGACAAAACCAAGAGTAACATGAAAGGTTAGTAGCCAAGAACCAAGTGACGTTACAGGGAAAAAAAATTGAACACAAAATTGGGTAATTCATTCATTTCTAACAGTGTTAGATCGAGGAGGTGGTTTTAAAATACATAAAAATTTGGCTCTATGTTTTTAAAAAAAGACGTCCTTGGAAAATTTGACTACTAACTTTA