Transcript asmbl_8616

Sequence
Transcript Sequence for observation asmbl_8616 of TGE0014537:
GGATCCGGTTCCGCCCTCCCTCTTGCTGCCGACCCTCCGGGGCTAGCGCCCGAGTTCCCTTTCCCAGAGTCCTCTGCGCCGTGAAGAAGCGGCTCCCGGGGACCGGGGGCATTTTGCGTTGGCTGGAGCCGGAGTAACAAGATGGCGGCGTCGGCGGAGTGACAGGGGTCCCTCCGGGAGGGAGCCGGCAGCAGTGGTGGCAGCGGGATCGCCGCCCTAACTCACCGCGCCCCTTTTCCAGCCCGCGACGTCGCCGCGAAAGCGAGGCAGCAGCGGCCGCCCAGACACAAGTGGCCCAGCCTGGTAACCGCGAGGACCCCTCACACACTGCGGCCTGGCGAGAAGAAACCTGCCTGAGCGGCGGTGATCAGGTTCCCCTCGGCTGATTCCGGGCCTGGTAACGCCGAGCCAACGCTTTCAGCTTCCTGCCGCCCTCCTCCGCAGCCTTGCTCCGGGGACGAGCCCAGAGGCCTCCGTCCTCCTCTCAGAGGTGTCGGGGCTCGGCCCCAGCCCCCGTCTGCGCCTCTCAGGATGGCGAGCAGCAGCGGCTCCAAAGCCGAATTCATTGTCGGAGGGAAATATAAACTGGTACGGAAGATCGGGTCTGGCTCCTTCGGGGACATTTACCTGGCGATCAACATCACCAATGGCGAGGAAGTGGCAGTGAAGCTAGAATCTCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAGAGCAAACTCTATAAAATTCTTCAGGGTGGGGTTGGCATCCCCCACATACGGTGGTATGGTCAGGAAAAAGACTACAATGTGCTAGTCATGGATCTTCTTGGACCCAGCCTTGAAGACCTCTTCAATTTCTGTTCGAGAAGGTTCACAATGAAAACTGTACTTATGTTAGCTGACCAGATGATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAACCAGATAACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTTATTCCTTATTGATTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACAAGGCAACACATACCATACAGAGAAGATAAAAATCTCACTGGCACTGCCCGATATGCTAGCATCAATGCACATCTTGGTATTGAACAGAGTCGCCGAGATGACATGGAATCATTAGGATATGTTTTGATGTATTTTAATAGAACCAGCCTGCCATGGCAAGGACTAAAGGCTGCAACAAAGAAACAAAAATATGAAAAGATTAGTGAAAAGAAGATGTCCACTCCTGTTGAAGTTTTATGTAAGGGGTTTCCTGCAGAATTTGCCATGTACTTAAACTATTGTCGTGGGCTGCGCTTTGAGGAAGCCCCGGATTACATGTATCTGAGGCAGCTATTCCGCATTCTTTTCAGGACCCTGAACCACCAATATGACTACACATTTGATTGGACAATGTTAAAGCAGAAAGCAGCACAGCAGGCAGCCTCTTCAAGTGGGCAGGGTCAGCAGGCCCAAACCCCCACAGGCAAGCAAACTGACAAAACCAAGAGTAACATGAAAGGAACAAAGGAATCCATTTCTTATTTTAACTGTTGTTGCAGTGAAGATGGGTTTTTGGACTTTTAGAAGCCAGGAGATACCACCTAAAGTTCAAGATAAAAACCAAGGACTAATGCACACTGGAGAGAAGAATGCTTGCTTAGCACTTGAAGACCGAATGTCGAAATCATGCTGAATGCTTCTATTGTGATTTTTAACATCACTGACATCTTAGGATAATTCACTGGAGAAACATTGATCCCTGGGTGTGGAGTATCATAGCACACTGGACGATCTGAAGAATAAAATCTGGATTCGGCTGCTGTATTCTGCCAGGAATATCGTTAGGCTAGCCTTTAACCAGTCCGTAAACAATTGTAAATCATTAGTTGACTCAGCAATTCCTCAAATATCAGATTAAAGATGAACAGATAAAATTCTTACCTAGGTATAATTCTTATCCCTACACAACAGATTTCTACTATTTTGACTGCCAGTGTAACTTATATTTCCACATTTTAGTTTGTTAGTGACAGTGG