Transcript asmbl_38469

Sequence
Transcript Sequence for observation asmbl_38469 of TGE0001766:
GCGTGGGCGAGGCGGAGGAGAGCCGTGCGCAGCGGCGTATGTGGGGCCGTGTGCAGACCCGCGTGTGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCTACCTTGCGAGCCGTCTTCCCCAGGCCTGCGTCCGAGTCTCCGCCGCTGCGGGCCCGCTCCGACGCGGAAGATCTGACTGCAGCCATGAGCAGCAATGAGTGCTTCAAGTGTGGACGATCTGGCCACTGGGCCCGGGAATGTCCTACTGGTGGAGGCCGTGGTCGTGGAATGAGAAGCCGTGGCAGAGGTTTCCAGTTTGTTTCCTCGTCTCTTCCAGACATTTGTTATCGCTGTGGTGAGTCTGGTCATCTTGCCAAGGATTGTGATCTTCAGGAGGATGCCTGCTATAACTGCGGTAGAGGTGGCCACATTGCCAAGGACTGCAAGGAGCCCAAGAGAGAGCGAGAGCAATGCTGCTACAACTGTGGCAAACCAGGCCATCTGGCTCGTGACTGCGACCATGCAGATGAGCAGAAATGCTATTCTTGTGGAGAATTCGGACACATTCAAAAAGACTGCACCAAAGTGAAGTGCTATAGGTGTGGTGAAACTGGTCATGTAGCCATCAACTGCAGCAAGACAAGTGAAGTCAACTGTTACCGCTGTGGCGAGTCAGGGCACCTTGCACGGGAATGCACAATTGAGGCTACAGCCTAATTATTTTCCTTTGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTATTTTCTCTGAATCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGGCAACTCCCAGGCCAGTGAGCTTTACTTGCCGTGTAAAAGGAGGAAAGGGGTGGAAAAAAACCGACTTTCTGCATTTAACTACAAAAAAAGTTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTTGTTAAAGAACCCCCTTTCCGTGCCACTGGTGAATAGGGATTGATGAATGGGAAGAGTTGAGTCAGACCAGTAAGCCCGTCCTGGGTTCCTTGAACATGTTCCCATGTAGGAGGTAAAACCAATTCTGGAAGTGTCTATGAACTTCCATAAATAACTTTAATTTTAGTATAATGATGGTCTTGGATTGTCTGACCTCAGTAGCTATTAAATAACATCAAGTAACATCTGTATCAGGCCCTACATAGAACATACAGTTGAGTGGGAGTAAACAAAAAGATAAACATGCGTGTTAATGGCTGTTCGAGAGAAATCGGAATAAAAGCCTAAACAGGAACAACTTCATCACAGTGTTGATGTTGGACACATAGATGGTGATGGCAAAGGTTTAGAACACATTATTTTCAAAGACTAAATCTAAAACCCAGAGTAAACATCAATGCTCAGAGTTAGCATAATTTGGAGCTATTCAGGAATTGCAGAGAAATGCATTTTCACAGAAATCAAGATGTTATTTTTGTATACTATATCACTTAGACAACTGTGTTTCATTTGCTGTAATCAGTTTTTAAAAGTCAGATGGAAAGAGCAACTGAAGTCCTAGAAAATAGAAATGTAATTTTAAACTATTCCAATAAAGCTGGAGGAGGAAGGGGAGTTTGACTAAAGTTCTTTTTGTTTGTTTCAAATTTTCATTAATGTATATAGTGCAAAATACCATATTAAAGAGGGGAATGTGGAGGACTG