Transcript asmbl_38468

Sequence
Transcript Sequence for observation asmbl_38468 of TGE0001765:
GCGTGGGCGAGGCGGAGGAGAGCCGTGCGCAGCGGCGTATGTGGGGCCGTGTGCAGACCCGCGTGTGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCTACCTTGCGAGCCGTCTTCCCCAGGCCTGCGTCCGAGTCTCCGCCGCTGCGGGCCCGCTCCGACGCGGAAGATCTGACTGCAGCCATGAGCAGCAATGAGTGCTTCAAGTGTGGACGATCTGGCCACTGGGCCCGGGAATGTCCTACTGGTGGAGGCCGTGGTCGTGGAATGAGAAGCCGTGGCAGAGGTGGTTTTACCTCGGATAGAGGTTTCCAGTTTGTTTCCTCGTCTCTTCCAGACATTTGTTATCGCTGTGGTGAGTCTGGTCATCTTGCCAAGGATTGTGATCTTCAGGAGGATGCCTGCTATAACTGCGGTAGAGGTGGCCACATTGCCAAGGACTGCAAGGAGCCCAAGAGAGAGCGAGAGCAATGCTGCTACAACTGTGGCAAACCAGGCCATCTGGCTCGTGACTGCGACCATGCAGATGAGCAGAAATGCTATTCTTGTGGAGAATTCGGACACATTCAAAAAGACTGCACCAAAGTGAAGTGCTATAGGTGTGGTGAAACTGGTCATGTAGCCATCAACTGCAGCAAGACAAGTGAAGTCAACTGTTACCGCTGTGGCGAGTCAGGGCACCTTGCACGGGAATGCACAATTGAGGCTACAGCCTAATTATTTTCCTTTGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTATTTTCTCTGAATCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGGCAACTCCCAGGCCAGTGAGCTTTACTTGCCGTGTAAAAGGAGGAAAGGGGTGGAAAAAAACCGACTTTCTGCATTTAACTACAAAAAAAGTTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTTGTTAAAGAACCCCCTTTCCGTGCCACTGGTGAATAGGGATTGATGAATGGGAAGAGTTGAGTCAGACCAGTAAGCCCGTCCTGGGTTCCTTGAACATGTTCCCATGTAGGAGGTAAAACCAATTCTGGAAGTGTCTATGAACTTCCATAAATAACTTTAATTTTAGTATAATGATGGTCTTGGATTGTCTGACCTCAGTAGCTATTAAATAACATCAAGTAACATCTGTATCAGGCCCTACATAGAACATACAGTTGAGTGGGAGTAAACAAAAAGATAAACATGCGTGTTAATGGCTGTTCGAGAGAAATCGGAATAAAAGCCTAAACAGGAACAACTTCATCACAGTGTTGATGTTGGACACATAGATGGTGATGGCAAAGGTTTAGAACACATTATTTTCAAAGACTAAATCTAAAACCCAGAGTAAACATCAATGCTCAGAGTTAGCATAATTTGGAGCTATTCAGGAATTGCAGAGAAATGCATTTTCACAGAAATCAAGATGTTATTTTTGTATACTATATCACTTAGACAACTGTGTTTCATTTGCTGTAATCAGTTTTTAAAAGTCAGATGGAAAGAGCAACTGAAGTCCTAGAAAATAGAAATGTAATTTTAAACTATTCCAATAAAGCTGGAGGAGGAAGGGGAGTTTGACTAAAGTTCTTTTTGTTTGTTTCAAATTTTCATTAATGTATATAGTGCAAAATACCATATTAAAGAGGGGAATGTGGAGGACTG