Transcript asmbl_13549

Sequence
Transcript Sequence for observation asmbl_13549 of TGE0000171:
GCTTTCTCTAGCACAGGAGGACTTGATTTCAAACAGAAATCAAATTGGAAATCAAAATAAATTGATTCAAGAACTGAAGACTGCCAAGGCTACATTGGAGCAGGATTCAGCAAAGAAAGAACAGCAATTGCAGGAGCGATGTAAAGCACTACAAGACATTCAGAAAGAAAAGTCACTGAAAGAAAAAGAACTGGTAAATGAGAAGTCTAAATTGGCAGAGATAGAAGAAATTAAATGTAGACAAGAAAAAGAAATCACTAAACTAAACGAAGAACTCAAGTCCCACAAACTAGAAAGCATAAAGGAGATAACAAATCTTAAAGATGCTAAACAGCTTCTAATTCAGCAGAAATTAGAACTTCAAGGAAAAGCGGACTCCCTGAAGGCAGCTGTTGAACAGGAGAAGAGAAATCAGCAGATACTAAAAGACCAGGTGAAAAAGGAAGAAGAGGAGCTGAAGAAAGAATTTATTGAGAAAGAAGCTAAGTTGCATTCCGAAATAAAAGAAAAGGAAGTAGGAATGAAGAAGCATGAAGAAAATGAGGCTAAACTTACCATGCAGATTACAGCATTAAATGAAAACTTAGGCACTGTGAAGAAGGAGTGGCAATCTAGTCAACGGAGAGTTAGTGAGCTTGAGAAACAAACGGATGACTTACGGGGTGAAATTGCAGTATTAGAAGCAACGGTTCAGAATAATCAAGATGAAAGGAGAGCACTACTGGAAAGATGTCTTAAAGGAGAAGGTGAAATAGAAAAGCTTCAAACCAAAGTATTAGAATTGCAAAGAAAGCTGGATAATACAACTGCAGCAGTGCAGGAGCTGGGCAGAGAAAACCAATCACTTCAGATCAAACATACACAAGCGTTGAATAGAAAGTGGGCCGAAGACAATGAAGTACAAA