Transcript asmbl_78139

Sequence
Transcript Sequence for observation asmbl_78139 of TGE0007724:
CCGAGAGCTCCACTCTGGTTTCAGGCGTCGTCTTGAGCTTGTTGTTCCGTGCCGTGGGAGTGACGGGGAGTCTTCTGGCAGAAAAGTCTCTGAATGTAGGTGTGGAATCTTCATTCCAGTTGAGAGTGGACCGTTTTAAGTTGGCTGTGGGTCCAGGAATAGCCTTGGAACCAAAATGGGACATGAGTTGAAGACAATCTAATCTCTGCCCTGAATCTGTTCTAGAGTGGACAATACATGGATTTAGATGCTGTTACAAAACACTCAGCATTACATGCAAAGCCCAATGGACTCATTCTTCAATATGGGACTGCTGGATTTCGAATGAAAGCAGAACATCTTGATCATGTCATGTTTCGCATGGGATTGTTAGCTGTCCTGAGGTCAAAATATACAAAATCTACAATAGGAGTCATGGTAACAGCATCACACAATCCTGAGGAAGACAATGGTGTCAAATTGGTTGATCCTTTGGGTGAAATGTTGGCACCTTCCTGGGAGGAACATGCTACCTGTTTGGCAAATGCTGAGGAAGAAGATATGCAGAGTGTGTTGATGGACATCAGCGAGAAAGCAGCGGTAGATCTGCAACAAGATGCCTTCGTAGTGATTGGTAGAGATACCAGGCCCAGCAGTCAGAAACTTTCACAGTCTGTAATAGATGGTGTCACTGTTTTGGGAGGTCAGTTCCATGATTATGGCTTGTTAACAACACCCCAGCTGCACTACATGGTATACTGTCGAAATACGAATGGGCAATATGGAAAGGCAACCATAGAAGGTTACTACCAGAAGCTCTCTAAGGCTTTTGTGGAACTTACCAAACAGGCTTTCTGCAGTGGAGATGAATATCGATCACTTAAGGTTGACTGTGCAAATGGCATAGGGGCCTTGAAGCTAAGAGAAATGGAATACTACTTCTCCCAGGAGCTGTCAGTTCAGCTGTATAATGATGGGACCAAAGGGAAACTCAATCATTTATGTGGGGCTGACTTTGTGAAAAGTCATCAGAAACCTCCACAAGGAATGGAAATGAAGTCCAATGAAAGATGTTGTTCCTTTGATGGAGATGCAGACAGAATTGTTTATTATTATCATGATGCAGATGGCCACTTTCATCTCATAGATGGTGACAAGATAGCAACTCTCATTAGCAGTTTCCTTAAAGAGCTCCTATTGGAGATTGGGGAAAGTTTGAATATTGGTGTTGTACAAACTGCATATGCAAATGGAAGTTCAACACGCTATCTTAAAGAAGTTATGAAGGTACCTGTCTATTGTACTAAAACTGGTGTAAAACATTTGCACCACAAGGCTCAAGAGTTTGATATTGGAGTTTATTTCGAAGCAAATGGTCATGGCACAGTACTGTTTAGTAAAGCTGCTGAAATGAAGATAAGAGAACTAGCAAAAGAATTAGAAGATAAGAAAAGGAAAGCTGCTAAGATGCTTGAAAACGTTATTGACTTGTTTAACCAGGCAGCTGGTGATGCTATTTCTGACATGCTGGTGATTGAGGCAATCTTGGCTCTGAAAGGCTTGACTGTACAACAGTGGGATGCTCTCTATACGGATCTTCCAAACAGACAGCTCAAAGTTAAGGTTGCAGACAGGCAACTTATTAGCACCACTGATGCTGAAAGGCAAGCAGTTACACCCCCAGGACTACAGGAGGCAATCAATGACCTGGTGAAGAAGTACGAGCTTTCCCGAGCTTTTGTCCGGCCATCTGGTACAGAAGACATAGTCCGAGTATATGCAGAAGCAGACTCACAAGAAAGTGCGGATAGCCTTGCATATGAAGTGAGCGTGGCAGTATTTCAGCTGGCTGGAGGAGTTGGAGAAAGTCCCCAACCAGGTTTCTGAAGACAGTTTTTATATTTATGAGAAACTGGATTTTTAAAAAGTTTTTACAAAATACTGCCATTATTGTGACAGTTCCAAACACATTTATAATCATAACGTTTACAGTGCACCTTACTGGATTGTTTCTAGATGATTGCTTTTCTTAAACACTACCAGAATAATACTTTAGAGATAGCTAAGCCTTATACTTGTTAAATTCAGTTTAAAAATGAAACCTACTTCTAGTTTCACCAATGTAAACTATTGGAGCTTATGTACATGATTCAGTCATTAATTTTTTAATATATGCTGGGAAAAAATCTTA