Transcript asmbl_78138

Sequence
Transcript Sequence for observation asmbl_78138 of TGE0007724:
CCGAGAGCTCCACTCTGGTTTCAGGCGTCGTCTTGAGCTTGTTGTTCCGTGCCGTGGGAGTGACGGGGAGTCTTCTGGCAGAATTGAGAGTGGACCGTTTTAAGTTGGCTGTGGGTCCAGGAATAGCCTTGGAACCAAAATGGGACATGAGTTGAAGACAATCTAATCTCTGCCCTGAATCTGTTCTAGAGTGGACAATACATGGATTTAGATGCTGTTACAAAACACTCAGCATTACATGCAAAGCCCAATGGACTCATTCTTCAATATGGGACTGCTGGATTTCGAATGAAAGCAGAACATCTTGATCATGTCATGTTTCGCATGGGATTGTTAGCTGTCCTGAGGTCAAAATATACAAAATCTACAATAGGAGTCATGGTAACAGCATCACACAATCCTGAGGAAGACAATGGTGTCAAATTGGTTGATCCTTTGGGTGAAATGTTGGCACCTTCCTGGGAGGAACATGCTACCTGTTTGGCAAATGCTGAGGAAGAAGATATGCAGAGTGTGTTGATGGACATCAGCGAGAAAGCAGCGGTAGATCTGCAACAAGATGCCTTCGTAGTGATTGGTAGAGATACCAGGCCCAGCAGTCAGAAACTTTCACAGTCTGTAATAGATGGTGTCACTGTTTTGGGAGGTCAGTTCCATGATTATGGCTTGTTAACAACACCCCAGCTGCACTACATGGTATACTGTCGAAATACGAATGGGCAATATGGAAAGGCAACCATAGAAGGTTACTACCAGAAGCTCTCTAAGGCTTTTGTGGAACTTACCAAACAGGCTTTCTGCAGTGGAGATGAATATCGATCACTTAAGGTTGACTGTGCAAATGGCATAGGGGCCTTGAAGCTAAGAGAAATGGAATACTACTTCTCCCAGGAGCTGTCAGTTCAGCTGTATAATGATGGGACCAAAGGGAAACTCAATCATTTATGTGGGGCTGACTTTGTGAAAAGTCATCAGAAACCTCCACAAGGAATGGAAATGAAGTCCAATGAAAGATGTTGTTCCTTTGATGGAGATGCAGACAGAATTGTTTATTATTATCATGATGCAGATGGCCACTTTCATCTCATAGATGGTGACAAGATAGCAACTCTCATTAGCAGTTTCCTTAAAGAGCTCCTATTGGAGATTGGGGAAAGTTTGAATATTGGTGTTGTACAAACTGCATATGCAAATGGAAGTTCAACACGCTATCTTAAAGAAGTTATGAAGGTACCTGTCTATTGTACTAAAACTGGTGTAAAACATTTGCACCACAAGGCTCAAGAGTTTGATATTGGAGTTTATTTCGAAGCAAATGGTCATGGCACAGTACTGTTTAGTAAAGCTGCTGAAATGAAGATAAGAGAACTAGCAAAAGAATTAGAAGATAAGAAAAGGAAAGCTGCTAAGATGCTTGAAAACGTTATTGACTTGTTTAACCAGGCAGCTGGTGATGCTATTTCTGACATGCTGGTGATTGAGGCAATCTTGGCTCTGAAAGGCTTGACTGTACAACAGTGGGATGCTCTCTATACGGATCTTCCAAACAGACAGCTCAAAGTTAAGGTTGCAGACAGGCAACTTATTAGCACCACTGATGCTGAAAGGCAAGCAGTTACACCCCCAGGACTACAGGAGGCAATCAATGACCTGGTGAAGAAGTACGAGCTTTCCCGAGCTTTTGTCCGGCCATCTGGTACAGAAGACATAGTCCGAGTATATGCAGAAGCAGACTCACAAGAAAGTGCGGATAGCCTTGCATATGAAGTGAGCGTGGCAGTATTTCAGCTGGCTGGAGGAGTTGGAGAAAGTCCCCAACCAGGTTTCTGAAGACAGTTTTTATATTTATGAGAAACTGGATTTTTAAAAAGTTTTTACAAAATACTGCCATTATTGTGACAGTTCCAAACACATTTATAATCATAACGTTTACAGTGCACCTTACTGGATTGTTTCTAGATGATTGCTTTTCTTAAACACTACCAGAATAATACTTTAGAGATAGCTAAGCCTTATACTTGTTAAATTCAGTTTAAAAATGAAACCTACTTCTAGTTTCACCAATGTAAACTATTGGAGCTTATGTACATGATTCAGTCATTAATTTTTTAATATATGCTGGGAAAAAATCTTA