Transcript asmbl_78120

Sequence
Transcript Sequence for observation asmbl_78120 of TGE0002372:
CAGAGACTGGGGGACGGGGCTGAGAGAGCGAGAGAGGGAGGGAGTGAGCCAACGAGCGTGCGAGCGAGGAGGAGAAAGGCGGCCACTCGAGCTTGAGCGGCCGCAGACGGGAGTGGGAGCAGTGGGGGAAAGGAGCAGGGAGGGGAAAACGACAGGCCGAGACAAGGCAGACAGAGGCTGGTGGTGTGGTTGTAGGGGGAAAGGAGGAGCTGGAGGAGGGCACGGGCTGAGGGAGTGAGTGAGGAGCGGACGCGCGAAGGGAGGGGAGGGAAAGGGGGGGGTCACGCGGGCGCGCGCGCGCACCGGGAGCGCGCTCGGAGGCGAGTGGAACTGGATCGGGTTTGCTGCCAGCGGCGTGAGCTTCGGCCGCCATTTTACAACAGCTCCACTCGCGCCGGACACAGGGAGCAGCGAGCACGCGTTTTCCGCAACCCGATCTCCTCGGACAGGATTCCTCCGCCGCAGCCCAACGGGGAGATCTCTGGAAACATGGCTACAGAACATGTTAATGGAAATGGTACTGAAGAGCCCATGGATACTACTTCTGCAGTTATCCATTCAGAAAATTTTCAGACATTGCTTGATGCTGGTTTACCACAGAAAGTTGCTGAAAAACTAGATGAAATTTACGTTGCAGGGCTGGTTGCACATAGTGATTTAGATGAACGAGCTATCGAAGCTTTAAAAGAATTCAATGAAGACGGCGCATTGGCAGTTCTTCAGCAGTTTAAAGACAGTGATCTCTCTCATGTTCAGAACAAAAGTGCCTTTTTATGTGGAGTCATGAAGACTTATAGGCAGAGAGAAAAACAGGGGACCAAAGTAGCAGATTCTAGCAAAGGACCAGATGAGGCAAAAATTAAGGCACTCTTGGAAAGAACAGGCTACACACTTGATGTGACTACTGGACAGAGGAAGTATGGAGGACCACCTCCAGATTCCGTTTATTCAGGTCAGCAGCCTTCTGTTGGCACTGAGATATTTGTGGGAAAGATCCCAAGAGATCTATTTGAGGATGAACTTGTTCCATTATTTGAGAAAGCTGGACCTATATGGGATCTTCGTCTAATGATGGATCCACTCACAGGTCTCAATAGAGGTTACGCGTTTGTCACTTTTTGTACAAAAGAAGCAGCTCAGGAGGCTGTTAAACTGTATAATAATCATGAAATTCGTTCTGGAAAACACATTGGTGTCTGCATCTCAGTTGCCAACAATAGGCTTTTTGTGGGCTCTATTCCTAAGAGTAAAACCAAGGAACAGATTCTCGAAGAATTTAGCAAAGTAACAGAGGGTCTTACAGACGTCATTTTATACCACCAACCAGACGACAAGAAAAAAAACAGAGGCTTTTGCTTTCTTGAATATGAAGATCACAAAACAGCCGCTCAGGCAAGGCGTAGGTTAATGAGTGGTAAAGTCAAGGTCTGGGGAAATGTTGGAACTGTTGAATGGGCTGATCCTATAGAAGATCCTGATCCCGAGGTTATGGCAAAGGTAAAAGTGCTGTTTGTACGCAACCTTGCCAATACCGTAACAGAAGAGATTTTAGAAAAGGCATTTAGTCAGTTTGGGAAACTGGAACGAGTGAAGAAACTAAAAGATTATGCTTTCATTCATTTTGATGAACGAGACGGTGCTGTCAAGGCTATGGAAGAAATGAACGGCAAGGACTTGGAGGGAGAAAATATTGAAATTGTTTTTGCTAAGCCACCAGATCAGAAAAGGAAAGAAAGAAAAGCTCAGAGGCAAGCAGCAAAGAATCAAATGTATGATGATTACTACTATTATGGCCCACCTCATATGCCCCCTCCAACAAGAGGTCGAGGGCGTGGAGGTAGAGGTGGTTATGGATATCCTCCAGATTATTATGGATATGAAGATTATTATGATTATTATGGCTATGATTACCATAACTATCGTGGTGGATATGAAGATCCATACTATGGTTATGAAGATTTTCAAGTTGGAGCTAGAGGAAGGGGTGGTAGAGGAGCAAGGGGTGCTGCTCCATCCAGAGGTCGTGGGGCTGCTCCTCCCCGCGGTAGAGCCGGTTATTCACAGAGAGGAGGTCCTGGATCAGCAAGAGGCGTTCGTGGTGCGAGAGGAGGTGCCCAACAACAAAGAGGCCGCGGGGTACGTGGTGCGAGGGGTGGCCGCGGTGGAAATGTAGGAGGAAAGCGCAAAGCTGATGGGTACAACCAGCCAGATTCCAAGCGGCGCCAGACCAATAATCAGAACTGGGGCTCCCAACCCATTGCTCAGCAACCGCTCCAAGGTGGTGATCATTCTGGTAACTATGGTTACAAATCTGAAAACCAGGAGTTTTATCAGGATACCTTTGGGCAACAGTGGAAGTAGAAACAGTAGGGCCTCTGTAAAATTGGAGACTGATAGGTTGATCAGAAACTGGCCCTAAATCTGAATGGGTGCCGCTATAATTTGACATCTGGCAAGATTTCCCTTTATGTATATATTTTAACAATTCGCTTGGACACGAACAAAACCACACTTCTAACTGCTTCTGGCGAACTGATTTTATTTTTATTTAAATTTTTTTTCAATAAAGGTATTCTTAGATATTGAAAGAAATAGTTAATGAGTTTGCATTTGTACTTGAGAAAATTTGGCTCAAGTTCACTTGGCTGTAGTGTATACGATGTTTCCAGTAGTGTTTAACACAATTTGGTTTCTTGAGAGGTAGTTGATTAAAACTGAGTATGTCTTTAATATCTTGTATCAGAATATTTGTATGTTACCAACTTAAATTGCTAGAATAAGGTAAATTGAAACACAACTGCTATTTTTAATTTAGAACTTTGAC