Transcript asmbl_76706

Sequence
Transcript Sequence for observation asmbl_76706 of TGE0007575:
GGAAGTTGACGACTCTAGGCCGTAAGTCGCCCTCCGCGGGCCGCATCGTAGCATGTTGCGCGGACCCGGCTACTTTCTCTGGGTTCCCGTGCCACCCGCAGCGGCCCTGGCTGTGGCTCTGCTGTCGTCGCTTTCGCACTGCTCCTTCCTGGAGCCGGCGGACCCTGTGATTTCGTCGCTCAGCCCATACTTCGGCACCAAGACGCGCTACGAAGATGCGAACTGTGGGCTGCTGCGGGACCCCGAGGTGCCGCGGCGGGACCCGGAGCTGCTGGAGGACACCTGCACCCCATTGCAGCTTGTCGCCCTCATCCGCCACGGCACCCGCTATCCTACGGCCAAACAGATCCGCAAGCTGCGGCAGTTACACGGACTGCTGCAGGCCCGCAGGCCCAGGGATGACAGGGCCGACGCCGTCGGCGGCCGAGACCTAGGCGCTGCGCTGGCCAACTGGCCGCTGTGGTACGCGGACTGGATGGACGGGCAGCTGGTGGAGAAGGGGCGGGAGGACATGCGACAGCTGGCGCTGCGCCTGGCCTCCCTTTTCCCGGCCCTCTTCAGCCACGAGAACTACAGCCGCCTGCAGCTCGTCACCAGCTCCAAGCACCGCTGCGTGGAGAGCGGCGTCGCCTTCCTGAAGGGGCTGTGGCAGCACTATCACCCTGGGTTGCCGCCGCCCGACGTCGCAGATATGGAGTGCAACCCTCCAAGAATTAATGATAAACTAATGAGGTTCTTCGATCATTGTGAGAAGTTTTTAACCGAAGTGGAAGGGAATGATACAGCTCTTTATCATGTAGAAGCCTTCAAAACTGGACCAGAAATGCAGAACATTTTGAAAAAAGTTGCAGCTGCTTTGCAAGTGCCATTCAACAGTTTAAATGCAGATTTAATTCAGGTAGCTTTTTTTACCTGTTCATTTGACCTGGCAATTAAAGGTGTTAAATCTCCTTGGTGTGATGTCTTTGACACAGATGATGCAAAGGTATTAGAATATTTAAATGATCTAAAACAATATTGGAAAAGAGGATATGGGTATACGATCAATAGTCGATCCAGCTGCACCTTATTTCAGGATATCTTTCAGCATTTGGACAAAGCAGTTGAACAGAAAAAAAGGTCTCAGCCAGTTTCCTCTCCAGTCATTCTTCAATTTGGTCATGCAGAGACCCTTCTTCCACTGCTTTCTCTCATGGGCTACTTCAAAGACAAGGAGCCCTTAACAGCTTACAATTACAAGGAACAAATGCATCGGAAGTTCCGAAGTGGTCACATTGTACCCTATGCCTCAAACCTAATATTTGTGCTTTACCATTGTAAAAATGCTAAGACTCTTAAAGAAGAATTCCGAGTGCAGATATTATTGAATGAAAAAGTGTTACCATTGGCTCACTCACAAGAAACCGTTTCTTTGTATGAAGATCTGAAGAACCACTACAAGGACATCCTTCAGAGTTGTAATACCGGTGAAGAATGTAAATTACCAAAGGTGAACAACACATCTGATGAGCTATGAGTAACTGGAGAACATTTTTAATTCATCAGAAATCTATAGGGAGTGATTACACGTGTGGAATTAGGTAGGCAATCCCTGGTTACAGAAAGCTTTCACACAGCTTGGGTGTTTCTGTCGTTTCACAGAGAAGCATTAAGTTTCCATCTGTGTCTAGACATGGATGTGTAAGAAACAATTCTTCATTGGAGCAGCTCTTGTAAGGGGAAAAAAAATCTATTCAAAGAAATAGCTGGCACTGCAAATGTTTACAGAAATTAAATTCTTCCTATTTGTATAAGAAATCTCACATTGAGAATGTTTTCAAAGTGATACTTGAAAGTGCTGGAGTAACAAAATATGTCAGTTGGATGACCTATAACTTGGTTGAACTATTTCTAAGATCTTTACCAGTTGTATTGAAGTTCTCTCTTTTTGCCTCAGGTAGCACAGTTCTAGTATTGTATTTCTTAATCTGAAATATTGTGACACACTGGAAGTATCACTTTGGAAGAAAGCTAACATCTCTCTATTTGAGAATTTGAAACAATATTAAGAACAAAGTCTGATTTAAAAGGACACTTTCACTGAAGGAAGACAAAAAGTACAGTAAAATAAATATTTTTGTTAATAGTATTTATAACGTATTTGAACATTTTTTCAATAATTCCTTTTAACCTCCTAGTAAATCCTGCAAGGCCAGTCTTTAATTATTTTCATATCTGTTTTACATATATGACAATGGAAGAACAAAGAGGACCATTCGCAACAAGTCAG