Transcript asmbl_7444

Sequence
Transcript Sequence for observation asmbl_7444 of TGE0007464:
AGCGGAATCGTCTTTGCTGAGGGTCACATTGAGCTGCGAGCTGTTTCAGGGGCGTCTTTAGAATGCCTGCCAGCACTCTTTGCCTCCAGGAGTCAGCAACATGGCAGAAGACATCAAGACCAAAATCAAGAACTACCAGACTGCCCCTTTTGACAGCCGCTTCCCCAACCAGAACCAGACCAGGAACTGTTGGCAGAACTACCTGGACTTCCACCGCTGTGAGAAGGCAATGACCGCTAAAGGGGGTGATGTCTCCGTATGTGAATGGTACCGGCGTGTGTACAAGTCCCTCTGCCCCATATCCTGGGTGTCAACCTGGGATGACCGCCGGGCAGAAGGCACATTTCCTGGGAAGATCTGAACTGGCTTCACTCCACCTCTCCTCTGTCTTCCATCCCTCTCCCAGGGAAGCGAGGGTGGACCTGGGTACATCCCACCCTGGGATCCTAAATCGTGGTTTAACTAATAATAAATACTTGTTGGAAAAGTA