Transcript asmbl_72502

Sequence
Transcript Sequence for observation asmbl_72502 of TGE0007389:
GACTGGAGTTGCTCTCGTAACGGACGAGCGTCTGTGGAGAAGCGGCTTTCTCTCTTATTGTCTCGTGGGCCCCGCTGGTTTAGTTGCTTGCAGGGTTCTCGAGCCCTTTCACGACCGTCACCATGGAGGTGTCACCACTGCAGCCTGTAAATGAAAATATGCAAATCAACAAAACAAAGAAAAATGAAGATGCTAAGAAAAGACTGTCTATTGAAAGAATCTATCAAAAGAAAACACAGTTGGAACACATTTTGCTCCGTCCAGACACTTACATTGGCTCTGTGGAATTAGTGACCCAGCAAATGTGGGTTTACGATGAAGATATTGGCATTAACTATAGGGAAGTCACTTTCGTTCCTGGTTTATACAAAATCTTTGATGAGATTCTAGTCAATGCTGCAGACAACAAACAAAGAGACCCAAAAATGTCTTGTATTAGAGTCACAATTGACCCGGAAAACAATTTAATTAGTATATGGAATAATGGAAAAGGTATTCCTGTTGTTGAACACAAAGTTGAGAAGATGTATGTCCCAGCTCTCATCTTTGGACAGCTCCTAACTTCTAGTAACTATGATGATGATGAAAAGAAAGTAACAGGTGGTCGAAATGGCTATGGAGCCAAATTGTGTAACATATTTAGTACCAAATTTACTGTGGAAACAGCCAGTAGAGAATACAAGAAAATGTTCAAACAGACGTGGATGGATAACATGGGGAGAGCTGGTGAGATGGAACTCAAGCCCTTTAATGGAGAAGATTATACATGTATTACCTTCCAGCCTGATTTGTCTAAGTTTAAAATGCAGAGCCTTGACAAAGATATTGTTGCACTGATGGTTAGAAGAGCATATGATATTGCTGGATCCACTAAAGATGTCAAAGTCTTTCTCAATGGAAATAAGTTGCCAGTGAAAGGATTCCGTAGCTATGTGGATATGTATTTGAAGGATAAAGTAGATGAAACTGGCAATCCATTGAAAATCATCCACGAACAAGTAAACCACAGGTGGGAAGTGTGTTTAACAATGAGTGAAAAAGGCTTTCAGCAAATTAGCTTTGTCAACAGCATTGCTACTTCCAAGGGTGGCAGACATGTTGATTATGTAGCTGATCAGATTGTGACTAAACTTGTTGATGTTGTGAAGAAGAAGAACAAGGGCGGTGTTGCAGTAAAAGCACATCAGGTGAAAAATCACATGTGGATTTTTGTGAATGCCTTAATTGAAAACCCAACCTTTGACTCTCAGACAAAAGAAAACATGACTTTACAAGTCAAGAACTTTGGATCAACATGCCAACTAAGTGAAAAATTCATCAAAGCTGCAATTGGCTGTGGTATTGTAGAAAGCATACTAAACTGGGTGAAGTTTAAGGCTCAAATCCAGTTAAACAAGAAGTGTTCCGCTGTGAAACATAACAGAATCAAGGGTATTCCCAAACTTGATGATGCCAATGATGCAGGGGGCCGAAACTCCACTGAGTGTACACTTATCCTGACCGAGGGAGACTCAGCTAAAACTTTGGCTGTTTCAGGCCTTGGTGTGGTTGGGAGAGATAGATATGGGGTTTTCCCTCTTAGAGGAAAAATACTCAATGTTCGAGAAGCTTCTCATAAACAGATAATGGAAAATGCCGAAATTAACAATATCATCAAGATTGTGGGTCTTCAATACAAGAAAAACTATGAAGATGAAGATTCATTGAAGACTCTTCGTTATGGGAAGATAATGATTATGACAGATCAGGACCAAGACGGTTCCCATATCAAAGGCTTGCTGATTAATTTTATCCATCACAACTGGCCCTCTCTTCTGCGACATCGTTTTCTGGAGGAATTTATCACTCCCATTGTAAAGGTGTCTAAAAACAAGCAAGAAATGGCATTCTATAGTCTGCCTGAATTTGAAGAATGGAAGAGTTCTACACCAAATCATAAAAAATGGAAAGTCAAGTATTACAAAGGTTTGGGCACCAGCACATCAAAAGAAGCTAAAGAATACTTTGCAGATATGAAAAGACATCGTATCCAGTTCAAATATTCTGGTCCTGAAGATGATGCTGCAATCAGCCTGGCCTTTAGCAAAAAACAGATAGATGATCGAAAGGAATGGTTAACTCATTTCATGGAGGATAGAAGACAACGAAAGTTACTTGGCCTTCCTGAGGATTACTTGTATGGGCAAACAACCACATATCTGACCTACAATGACTTCATAAACAAGGAACTAATCCTGTTCTCAAATTCTGATAACGAGAGATCTATCCCGTCTATGGTGGATGGTTTGAAACCAGGTCAGAGAAAGGTTTTGTTTACGTGTTTCAAACGGAATGACAAGCGAGAGGTGAAGGTAGCCCAGTTAGCTGGGTCAGTGGCTGAGATGTCCTCTTATCATCATGGTGAGATGTCACTAATGATGACCATTATCAATTTGGCTCAGAATTTTGTGGGTAGCAATAATCTGAACCTCTTGCAGCCCATTGGTCAGTTTGGTACCAGGCTGCATGGTGGCAAGGATTCTGCTAGTCCTCGATACATCTTCACAATGCTCAGCCCTTTGGCTCGGTTGTTATTTCCACCACAAGATGATCACACATTAAAGTTCTTATATGATGACAACCAGCGTGTGGAGCCTGAGTGGTACATTCCTATTATACCCATGGTGCTGATAAATGGTGCTGAAGGAATTGGTACTGGGTGGTCCTGCAAAATTCCCAACTTTGATATTCGTGAAGTCGTGAATAATATCAGGCTTTTGATGGATGGAGAAGAACCTTTGCCAATGCTTCCCAGTTACAAGAACTTCAAGGGTACTATTGAAGAGCTGGCTCCAAATCAGTATGTGATTAGTGGTGAAGTGGCTATTCTTAATTCCACAACCATTGAAATCTCAGAGCTTCCCATCAGAACATGGACCCAGACATATAAAGAACAGGTTCTGGAACCAATGTTGAACGGCACAGAGAAGACACCTCCTCTTATAACAGATTATAGGGAATACCATACAGATACCACTGTGAAGTTTGTTGTGAAAATGACTGAAGAAAAACTGGCAGAGGCCGAGAGAGTGGGACTACACAAAGTCTTCAAACTCCAAACTAGTCTCACATGCAACTCTATGGTGCTTTTTGACCACGTAGGCTGTTTAAAGAAATATGACACAGCGTTGGATATTCTAAGAGACTTCTTTGAACTCAGGCTTAAATATTATGGATTAAGAAAAGAATGGCTTCTAGGAATGCTTGGCGCTGAATCTGCTAAACTGAACAATCAGGCTCGCTTCATCTTAGAGAAAATAGATGGCAAAATAATCATTGAAAATAAGCCTAAGAAAGAATTGATTAAAGTTTTGATTCAGAGAGGATATGATTCGGATCCTGTGAAAGCTTGGAAAGAAGCCCAGCAAAAGGTTCCAGATGAAGAAGAAAACGAAGAGAGCGATAATGAAAAGGAAACTGAAAAGAGTGACTCTGTAACTGGACCAACCTTCAACTACCTTCTTGATATGCCTCTTTGGTATCTTACCAAGGAAAAGAAAGATGAACTATGCAAATTAAGAAAGGAAAAAGAACAAGAGCTAGAAACATTAAAGAAAAAGAGTCCATCAGATTTGTGGAAAGAAGACTTGGCTGCTTTTATTGAAGAGCTGGAGACTGTTGAAGCCAAGGAAAAACAAGATGAACAAGTAGGACTTCCTGGGAAAGGGGGGAAAGGAAAAGGGAAAAAAACACAAATGGCTGAAGTTTTGCCTTCACCAAGTGGAAAAAGAGTCATTCCCCGAGTTACCATAGAGATGAAAGCAGAGGCAGAAAAGAAAATTAAAAGGAAAATTAAGAATGAAAATTCTGAAGGAACTCCTCAAGAGAATGGTATGGAACCCGAAAGCCTAAAACAAAGATTAGAGAAGAAACTGAAAAAAGAACCAGGTACCAAGACGAAGAAACAAACTACATTGCCATTTAAACCAGTCAAAAAAGGAAAGAAGAGAAACCCCTGGTCTGATTCAGAATCAGATGCGAGCAGTAACGAAAGTGATTTTGATGTCCCTCCACGAGAAATAGAGCCACGGAGAGCAGCAACAAAAACCAAATTCACAGTGGATTTAGATTCAGATGAAGATTTCTCAGATTTTGATCAAGAAACTCAAGATGAAGATTTTGTGCCATCTGATGCTAGTCCAGTTAAGACCAGAACTTCCCCGAAACGTGCTAACAAAGAACTGAAGCCACAGAAGAGCACCACGTCAGTAACGGACTTTGATGCTGATGATGCCAAGGACGATGTTCCACTTTCTCCAAGTTCTCCTGCTGCTGATTTCCCAGCCGAAACAGAAATTGTAAACCCTGTTTCTAAAAAGAACGTGACAGTGAAGAAGACGGCAGCAAAAAGTCAGTCTTCCACCTCGACTACAGGTGCCAAAAAAAGGGCTGCACCAAAAAGAACCAAAAAGGATCCAGGCGTGAATTCTGATGCCCCTCAAAAGCCTGATCCCCCCAAAACCAAGACTCGCCGCAAAAGAAAGCCATCCACTTCTGATGATTCCGACTCTAACTTTGAGAAAATGATTTCTAAAGCAGTCACAAGCAAGAAATCCAAGGGGGAGAGTGATGACTTCCACCTGGACTTAGACTCAGCTGTGGCTCCTCGTGTAAAATCTGGGCGGGCAAAGAAGCCGATAAAGTACCTTGAAGAATCAGATGAAGATGATCTGTTTTAAAATGTGAGGTGACTATTTTTAGTGGTCTTATTGAGCCCAAGACTGGTTTGAATCTCTTAATTTCCTCCCCTTTAAATTTAGTTTGGGGAAAGTAGTTTTGATCTAAAATCACCAAAGTGAAGTATGTAGAGCCCAGCGTCCCTTATCTTTTTATGATACAGTCTAAATGGTGATACATCTCATGGGCATTGTTTTTTTCTCTGCTTTGTCTGTATTTTCATTCTGTTTCCTTTTGTCTTTAAAATCTGATTTTAACTTCTGGACTCCAGAGATAGTTATGTGGTCATTCCAGCATAATGTAGTTTGTTTATTGACCATACATTAAGCTAAAATTGGAGCACTTTGATATAAAAGTGTCTACTGTGCCTCCTTTCTTACCTTCATAAATATGAGATAGAGCATGATTAATTCTGTTTTATCTTAGTTATATAGGTAATTTTCCATCAGATAGAATTTTATAGTTCTAGTACAAATACTCCCCACTCAGCCTTTTATGTGCTGAATTTTTGTTCAAACAATGAGATATTGCTCATATTCTTCATACTCTTTTAGAATGTCAGCAGAGGCTAAAGAAAAACACCTTGGCTGTGTCTGTAGAACCTCAACACAGTCAAGAGGATGAAGAAAATTAGACCATAAGTTATATAAACCAGTGCTGTCTCAACTCTTGACTGTCCCCTCTGGCTGCCTCTGAGTCTGAATTTCCCAAAGAACAAATTTCTGGGGAGCACTAGATTGCAGAAGAGTGGGGACAGCATTCATTCAGAGACCTTAAATATTTTATTGATACCATATTCAGCAATGAGCTTTTATATCCATTTTGAGAAATCTCCATAATTTTCAACTTGTAAACTTTTTAAAGACCTTTCTGCATTTTACACATCTGTGATTTGAATAGTGTTATCAATGTTTTTGTAAATATTTAATATGTTTTTCTATTTAGCTAAATTCCAGCAATTTTGTACTTTAATAAAAT