Transcript asmbl_72482

Sequence
Transcript Sequence for observation asmbl_72482 of TGE0014198:
CGACCTGGCCCAGGAGCTTCCTGCTTCCCTCCCTCAACCCGGAACCTCCTCTCCGGATGCCGGCTTGCTGTTCACGTGCCCTCCTTGCACCTGTTTGGAAGTTTTGGTTGTCGTAGCTTTCGGTAGAGCAGGTCCCTCTGCAGCCATGTCGGCCAAGGCGATTTCAGAGCAGACTGGCAAAGAACTTCTTTACAAGTACATCTGCACCAGCTCGGCCATCCAGAACCGGTTCAAGTATGCCAGGGTCACCCCTGACACAGACTGGGCCCATCTGCTGCAGGACCACCCCTGGTTGCTCAGCCAAAGATTGGTGGTCAAGCCAGACCAACTGATCAAACGACGTGGAAAGCTGGGCCTAGTTGGGGTCAACCTCACTCTGGATGGTGTCAAGTCCTGGCTGAAGCCACGGCTGGGACAGGAAGCTCTGGTAGGCAAGGCCAGAGGCTTACTCAAGAACTTTCTGATCGAACCCTTCGTCCCACACAGTCAGGCAGAAGAGTTCTACGTCTGCATCTATGCTACCCGAGAAGGTGACTACGTCCTGTTCCACCACGAGGGAGGGGTGGACGTAGGCGACGTGGATGCCAAAGCCCAGAAACTGCTCGTTGGTGTGGATGAGAAGCTGAATCCTGAGGACATCAAGAAACACCTATTGGTCCATGCCCCTAAAGACAAGAAAGAAATTCTGGCCAGTTTTATCTCCGGCCTCTTCAATTTATATGAAGATCTGTACTTCACCTACCTCGAGATCAACCCCCTTGTTGTGACCAAAGATGGCGTCTACATTCTTGACTTGGCGGCTAAGGTAGATGCCACTGCCGATTACATCTGCAAAGTGAAGTGGGGCGATATAGAGTTCCCTCCCCCCTTTGGGCGTGAGGCTTATCCAGAGGAAGCCTACATTGCAGACCTGGATGCCAAAAGTGGAGCAAGCCTGAAGCTGACCTTGCTGAACCCCAAGGGGAGGATCTGGACCATGGTGGCTGGGGGTGGTGCCTCAGTCGTGTACAGTGATACCATCTGTGACCTAGGGGGTGTCAATGAGCTGGCGAACTATGGGGAGTACTCGGGTGCCCCCAGCGAGCAGCAGACCTATGACTATGCCAAGACGATCCTCTCCCTCATGACCCGCGAGAAGCACCCAGATGGCAAGATCCTCATCATTGGAGGCAGCATTGCGAACTTTACCAACGTGGCTGCCACGTTCAAGGGTATTGTGAGAGCGATTCGAGATTTCCAGGGCCCCCTAAAGGAGCACGAGGTCACTATCTTTGTCCGAAGAGGTGGTCCCAACTATCAAGAGGGCTTACGGGTGATGGGAGAAGTTGGGAAGACCACTGGAATCCCCATCCATGTGTTTGGCACAGAGACTCATATGACGGCCATTGTGGGCATGGCCCTGGGCCACCGGCCCATCCCCAATCAGCCACCTACAGCCGCCCATACTGCAAACTTCCTCCTCAACGCCAGTGGGAGCACATCGACTCCAGCCCCCAGCAGGACTGCGTCTTTTTCTGAGTCCAAGGCTGATGAAGTGGCACCTGCAAAGAAGGCCAAGCCTGCTATACCACAGGATTCAGTCCCAAGTCCAAGATCCCTGCAAGGAAGGAGCCACCTGGTGGAGGGAGGAGGTGAGAGGAATATAGCCTGCTGCTCTGGCCTGGCCCCTTGCCAGAGCCCCGGAGATAAGGGTGAGAAACCTCTTCATTAGACCTACACTGACCTAGAATCTTGAGAATTCAAATCCTGACCCGAGATGGTTTATGTCCAGATTTCAAGGTTATGAGATTCTTGGGGAATTATGTAATTTCTTTCCATCACCAAAATCAGGAGAGCTTAACACTTTCCCAGTGACTTTAAAAATAATTTATCAAGCCCCATTTGCCGATAGGCATGAGGCTGATTACACACCTTTCCTGTGAAATCGAGCAGGCCCTGTAGGAATCCTTCTGCTGGGCTTGTTCTCTGCAGGGAGAGTCCTTTCTCTGTTCGTTCCAGAAGAAATCGAGGCACCTCTTTCCCCAAGTTCTCAGAATTCCGTCCTCTTGACTTTCCTTTGTGGGTTTGATTAGCCTCCTTCCCTGGACTTGGGGCGTGGAGGGGTCTGGCAGGTAGCCCCTGCCCCTGTGGGTCTCACTGGATGTGTGTTCTGGGTGCACGTGTGGTGTCTTTGCCTACCAGGGAGGAGTGCC