Transcript asmbl_72394

Sequence
Transcript Sequence for observation asmbl_72394 of TGE0014189:
CTGCAGTCTGTGTGAGGGGCTGTAGGGATTCTCCCGGCATGGCCGGAGTATTTCCTTACCGAGGGCCGGGTAACCCGGTGCCCGGCCCTCTAGCCCCGCTGCCGGACTACATGTCGGAGGAGAAGCTGCAGGAGAAAGCCCGAAAATGGCAGCAGTTGCAGGCCAAGCGCTATGCGGAAAAGCGGAAGTTTGGATTTGTGGATGCTCAGAAGGAAGACATGCCCCCAGAACATGTTAGGAAGATCATTCGAGACCATGGAGACATGACCAACAGGAAGTTTCGCCATGACAAAAGGGTCTACTTGGGTGCCCTAAAGTATATGCCCCATGCAGTCCTCAAACTCCTGGAGAACATGCCTATGCCTTGGGAGCAGATTCGGGATGTACCTGTGCTGTACCACATCACCGGAGCTATTTCCTTTGTCAATGAGATTCCCTGGGTCATTGAGCCTGTCTACATCTCTCAGTGGGGATCAATGTGGATTATGATGCGGCGAGAAAAAAGAGATAGGAGGCATTTCAAGAGGATGCGTTTCCCCCCTTTTGATGATGAGGAGCCGCCTTTGGACTATGCTGATAACATCCTAGATGTTGAGCCACTGGAGGCCATTCAGCTAGAGCTGGACCCTGAGGAGGATGCTCCTGTGTTGGACTGGTTCTATGACCACCAGCCATTGAGGGACAGCAGAAAGTATGTGAATGGCTCCACTTACCAGCGCTGGCAGTTCACATTGCCCATGATGTCCACACTCTACCGCCTAGCCAATCAGCTCCTGACAGACTTGGTGGATGACAACTACTTCTATCTGTTTGATCTGAAGGCCTTCTTTACTTCTAAGGCGCTCAATATGGCCATTCCTGGAGGCCCCAAATTTGAACCTCTTGTTCGAGATATCAACCTACAAGATGAAGACTGGAATGAATTCAATGATATTAACAAGATCATCATTCGGCAGCCTATCCGCACTGAATACAAGATTGCTTTTCCTTACTTGTATAACAACCTTCCACACCACGTGCACCTTACCTGGTACCACACTCCTAATGTTGTATTCATCAAAACTGAGGATCCTGATTTGCCAGCTTTCTACTTTGATCCTTTGATCAACCCAATTTCCCATAGGCACTCTGTCAAGAGCCAGGAACCATTGCCAGATGATGATGAAGAGTTTGAGCTCCCAGAGTTTGTGGAGCCCTTCCTGAAGGACACACCCCTTTACACAGATAATACAGCAAATGGCATTGCCCTGCTGTGGGCCCCACGGCCCTTCAACTTACGCTCTGGTCGCACCCGCCGGGCCCTGGACATCCCCCTTGTCAAGAACTGGTATCGGGAGCACTGTCCTGCTGGACAGCCTGTGAAAGTGAGGGTCTCCTACCAGAAGCTGCTTAAGTACTATGTGCTTAATGCCCTGAAGCACCGGCCCCCTAAAGCCCAAAAGAAGAGGTATCTGTTCCGCTCCTTCAAAGCCACCAAATTCTTTCAGTCCACAAAGCTGGACTGGGTGGAGGTGGGATTACAGGTTTGCCGCCAGGGCTACAACATGCTTAACCTTCTCATTCACCGTAAAAACCTCAACTATCTGCACCTGGATTATAACTTCAACCTCAAGCCTGTCAAGACACTTACCACCAAGGAAAGAAAGAAATCTCGTTTTGGGAATGCTTTCCATCTGTGTCGAGAAGTTCTGCGTTTAACGAAGCTGGTGGTGGACAGTCATGTGCAGTACCGATTAGGCAATGTGGATGCCTTCCAGCTGGCAGATGGATTGCAATATATCTTTGCCCATGTGGGGCAGCTGACAGGCATGTACCGGTACAAATACAAGCTAATGCGGCAGATTCGCATGTGCAAGGACCTGAAGCATCTCATCTATTACCGCTTCAACACGGGCCCTGTAGGGAAGGGCCCTGGCTGTGGCTTCTGGGCTGCTGGCTGGAGAGTATGGCTGTTTTTCATGCGTGGCATCACCCCTTTGCTGGAGCGATGGCTGGGCAACCTCTTGGCCCGGCAGTTTGAAGGCCGACACTCGAAGGGGGTGGCGAAGACCGTAACAAAGCAACGAGTAGAGTCACATTTTGACCTTGAGCTTCGAGCAGCTGTGATGCATGACATTCTGGACATGATGCCTGAGGGGATCAAACAGAACAAGGCCCGGACAATCTTGCAGCACCTCAGTGAAGCCTGGCGCTGCTGGAAGGCCAACATTCCCTGGAAGGTCCCTGGGCTGCCAACGCCCATAGAGAATATGATCCTTCGATATGTAAAGGCCAAGGCTGACTGGTGGACCAACACTGCCCACTACAACCGAGAACGGATCCGCCGTGGGGCCACTGTGGACAAGACTGTTTGCAAAAAGAACCTGGGCCGCCTCACCCGGCTCTACTTGAAGGCAGAACAGGAGCGGCAGCACAACTACCTGAAGGATGGGCCTTACATCACAGCAGAGGAAGCGGTGGCAGTGTATACCACCACTGTGCATTGGTTGGAAAGCCGTAGGTTCTCACCCATTCCATTCCCCCCGCTCTCCTACAAGCATGACACCAAGTTGCTTATCTTGGCCTTGGAGCGGCTCAAGGAAGCTTACAGTGTGAAGTCTCGGTTAAACCAGTCCCAGAGAGAGGAGCTAGGCCTGATTGAGCAAGCCTATGACAACCCCCACGAGGCATTGTCCCGCATCAAGCGTCACCTCCTCACACAGAGAGCCTTTAAAGAAGTAGGCATTGAGTTCATGGATCTCTACAGCCACCTGGTGCCAGTGTATGATGTGGAGCCACTAGAGAAGATAACTGATGCCTACTTGGACCAGTACCTGTGGTATGAAGCTGACAAGCGACGCCTTTTCCCACCCTGGATCAAGCCTGCTGACACAGAACCACCTCCTCTGCTTGTTTATAAGTGGTGCCAAGGCATCAATAACCTGCAGGACGTGTGGGAGACAAGTGAGGGTGAATGCAATGTTATGCTGGAGTCACGTTTTGAGAAGATGTATGAAAAGATCGACTTGACCCTGCTTAATAGGCTGCTGCGACTCATTGTAGACCATAACATAGCTGACTACATGACAGCCAAGAACAATGTTGTCATCAACTATAAGGACATGAACCATACAAATTCATATGGGATCATCAGAGGCCTGCAGTTTGCCTCATTCATCGTGCAATACTATGGCCTGGTGATGGATTTGCTTGTGTTGGGATTACACCGAGCCAGTGAGATGGCTGGGCCGCCTCAGATGCCAAATGACTTTCTCAGTTTCCAGGACATAGCCACCGAAGCTGCCCACCCCATTCGTCTCTTCTGCAGATACATTGATCGCATCCATATTTTCTTCAGGTTCACAGCAGATGAGGCTCGAGACCTGATCCAGCGTTACCTGACAGAGCACCCTGACCCCAACAATGAAAACATCGTTGGCTATAATAACAAGAAATGCTGGCCCAGAGATGCCCGCATGCGCCTCATGAAGCATGATGTCAACTTGGGTCGGGCAGTGTTCTGGGACATCAAGAACCGTCTGCCAAGGTCAGTGACTACAGTTCAGTGGGAGAACAGCTTCGTGTCTGTGTACAGTAAGGACAACCCTAATCTGCTGTTCAACATGTGTGGCTTTGAGTGTCGTATCTTGCCTAAATGCCGCACCAGCTATGAGGAGTTCACCCACAAGGATGGAGTCTGGAACCTACAGAATGAGGTTACTAAGGAACGGACAGCCCAGTGTTTTCTGCGTGTGGATGATGAGTCAATGCAGCGTTTCCATAACCGCGTGCGTCAAATTCTGATGGCCTCTGGTTCCACCACCTTCACCAAGATTGTGAATAAGTGGAACACAGCTCTTATTGGCCTTATGACATACTTTCGGGAGGCTGTGGTGAACACCCAGGAGCTCCTGGACTTGCTGGTGAAGTGTGAGAACAAGATCCAGACACGTATCAAGATTGGCCTCAACTCCAAGATGCCAAGTCGGTTCCCCCCTGTTGTGTTCTATACCCCTAAGGAGTTGGGTGGACTCGGCATGCTCTCAATGGGCCATGTGCTTATCCCTCAGTCTGACCTCAGGTGGTCCAAGCAGACAGATGTAGGTATCACACACTTTCGTTCAGGAATGAGCCATGAAGAAGACCAGCTGATTCCCAACTTGTACCGCTACATACAGCCATGGGAGAGTGAGTTCATTGATTCTCAGCGAGTCTGGGCTGAGTATGCACTCAAGAGACAAGAGGCCATTGCTCAGAACAGACGACTGACCTTAGAAGATCTAGAAGATTCATGGGATCGTGGCATTCCTCGAATCAACACCCTCTTCCAGAAGGACCGGCACACACTGGCTTATGATAAGGGCTGGCGTGTTCGAACTGACTTTAAGCAGTACCAGGTTTTGAAGCAGAACCCTTTCTGGTGGACACACCAGCGGCATGATGGGAAGCTCTGGAACCTAAACAATTACCGTACAGACATGATCCAGGCCCTGGGTGGTGTGGAAGGCATCCTGGAGCACACACTCTTCAAAGGCACTTACTTTCCTACCTGGGAGGGGCTTTTCTGGGAGAAGGCCAGTGGTTTTGAGGAGTCTATGAAGTGGAAGAAGCTAACTAATGCTCAGCGATCAGGATTGAACCAGATTCCCAATCGTAGATTCACCCTCTGGTGGTCCCCAACCATCAACCGAGCCAATGTATATGTAGGATTTCAGGTGCAGCTGGATCTGACAGGTATCTTCATGCATGGCAAGATCCCCACACTGAAGATCTCTCTCATCCAGATTTTCCGAGCTCACTTGTGGCAGAAGATCCATGAGAGTATTGTTATGGATTTGTGTCAGGTGTTTGACCAGGAACTAGATGCACTAGAAATTGAAACAGTACAAAAGGAGACAATTCACCCCCGAAAGTCCTATAAGATGAACTCTTCCTGTGCAGATATCCTGCTCTTTGCCTCCTATAAGTGGAATGTTTCCCGACCCTCATTGCTGGCAGACTCCAAGGATGTGATGGACAGCACCACCACTCAGAAGTATTGGATTGACATCCAGTTGCGCTGGGGGGACTATGATTCCCATGACATTGAGCGCTATGCCCGGGCCAAGTTCTTGGACTATACCACAGACAACATGAGTATCTACCCTTCACCCACAGGTGTGCTCATTGCCATTGACCTGGCCTATAACCTGCACAGTGCCTATGGAAACTGGTTCCCAGGTAGCAAGCCTCTTATACAGCAGGCTATGGCCAAGATTATGAAGGCAAACCCTGCCTTGTATGTGTTACGTGAACGCATCCGCAAGGGGCTGCAGCTGTATTCATCTGAGCCCACTGAGCCCTATCTGTCCTCTCAGAACTATGGTGAGCTCTTCTCCAACCAGATTATTTGGTTTGTGGATGACACTAATGTCTACAGAGTGACTATTCACAAGACCTTTGAAGGGAACTTAACAACCAAGCCCATCAATGGGGCCATCTTCATCTTCAACCCACGCACAGGGCAGCTGTTTCTCAAAATAATCCATACATCTGTGTGGGCTGGACAGAAGCGTTTGGGGCAGTTGGCTAAGTGGAAGACAGCTGAGGAGGTGGCTGCCCTGATCCGGTCTCTGCCTGTGGAGGAGCAGCCCAAGCAGATCATTGTCACTAGGAAGGGCATGCTGGATCCATTGGAGGTACACTTGCTGGACTTCCCCAATATCGTGATCAAAGGATCAGAGCTTCAACTCCCTTTCCAGGCTTGTCTCAAGGTGGAAAAGTTTGGGGACCTCATCCTTAAAGCCACTGAGCCCCAGATGGTTCTCTTTAACCTCTATGATGACTGGCTCAAGACTATCTCATCTTACACGGCTTTCTCCCGCCTCATTTTAATTCTGCGTGCCCTGCATGTGAACAATGACCGGGCAAAGGTGATCCTGAAGCCAGATAAGACTACTATTACAGAACCACACCACATCTGGCCCACTCTGACTGACGAGGAATGGATCAAGGTGGAGGTGCAACTCAAGGATCTTATCTTGGCTGACTATGGCAAGAAAAACAATGTGAATGTGGCATCACTGACACAGTCAGAAATTCGAGACATCATCCTGGGTATGGAGATCTCGGCACCTTCACAGCAGCGGCAGCAAATAGCTGAAATTGAGAAGCAGACCAAGGAACAGTCACAGCTGACTGCAACACAGACTCGTACTGTCAATAAGCATGGCGATGAGATCATCACCTCTACCACCAGCAACTATGAGACCCAGACTTTCTCGTCTAAGACTGAATGGAGGGTCAGGGCCATCTCTGCTGCCAACCTGCACCTAAGGACCAATCATATCTATGTTTCATCCGATGACATCAAGGAGACTGGTTATACCTATATCCTTCCCAAGAATGTGCTTAAGAAGTTCATCTGCATATCTGACCTTCGAGCCCAAATTGCAGGATACCTGTATGGGGTGAGCCCACCGGATAACCCCCAGGTAAAGGAAATCCGCTGCATTGTGATGGTACCACAGTGGGGCACCCACCAGACTGTGCACCTGCCTGGCCAGCTGCCCCAGCATGAGTACCTCAAGGAGATGGAACCCTTAGGTTGGATCCACACTCAGCCCAATGAGTCCCCACAGTTATCGCCCCAGGATGTTACCACCCATGCTAAAATCATGGCTGACAACCCATCATGGGATGGTGAGAAGACCATCATCATCACCTGCAGCTTCACACCAGGCTCCTGCACACTGACAGCCTACAAGCTGACCCCCAGTGGCTATGAATGGGGCCGTCAGAACACGGACAAGGGCAACAACCCAAAGGGGTATCTACCCTCGCACTACGAGAGGGTCCAGATGCTACTGTCAGACCGCTTCCTTGGCTTCTTTATGGTCCCTGCCCAGTCTTCATGGAACTACAACTTTATGGGTGTCCGGCATGATCCCAACATGAAGTATGAGCTGCAGCTGGCAAACCCCAAAGAATTCTACCACGAGGTGCATAGACCCTCGCATTTCCTCAACTTCGCCCTCCTGCAGGAGGGTGAGGTCTACTCTGCGGACCGAGAGGACCTCTATGCCTAGTTGTTTCCTCACCTGCTTCAGACTCCAGAAAGGCTGGATGGAGCCTTTACCCTGCAGACAAGCTGATGACATTCAACAGCTTGGCTCCTTTTTTCTCTGTTTTGTGCTTGTGTTGACCTCCTGATGGCTTGTAATCCTGAACAAAGTATAATAAATTTTGTATAAATTG