Transcript asmbl_72357

Sequence
Transcript Sequence for observation asmbl_72357 of TGE0007360:
AGCAGCAGCAGCAGCAGCCGCCGCACCACCACCACCATTATTATTACTACAACCACAGCCACAACCACCATCACCACCACCATCACCAGCAGCCTCACCAATACCTGCAGCATGGAGCCGAGGGCAGCCCCAAGGCCCAGCCAAAGCCGCTGAAACATGAGCAGAAACACGCCCTCCAGCAGCACCAGGAAACGCCGAAGAAGAAAACAGGCTATGGTGAACTAAATGGTAATGCTGGAGAAAGAGAAGTATCTTTAAAGAACCTGGGTTCTGATGAAGCTACCAGCCCAATTTCCAGGGTCCTCAATGGCAACCAACAAGTTGTAGACACTAATCCGAAGCAGACTGTAAAGACCAGCACCTTTGGGAAAGCAGGAATTAAAACCAGGAATTTCATTCAGAAGAACAGTATGGACAAAAAGAATGGAAAGTCTTATGAAAATAAATCTGGAGAGAACCAGTCTGTAGATAAGAGTGATGCTGTAGCAATTCCAAATGGTGTTGTAACAAATAATTCTGGCTATATTACTAATGGTTATATGGGCAAAGGAGCAGATAATGATGGTAGTGGATCTGAGAGCGGATATACCACTCCTAAAAAAAGGAAAGCTAGGCGCAATAGTGCCAAGGGTTGTGAAAACCTTAATTTAGTGCAGGACAAAATAATGCAACAAGAGACCAGTGTCCCAACCTTAAAACAGGGACTTGAAACTTTCAAGCCTGACTATAGTGAACAAAAGGGAAATCGAGTAGATGGTTCAAAGCCCATTTGGAAGTATGAAACTGGGCCTGGAGGAACAAGTCGAGGAAAACCTTCTGTGGGTGATATGCTGCGGAAAAGTTCTGATATTAAACCTGGCGTGAGCAGCAAAAAATTTGATGACCGGCCCAAAGGAAAGCATGCTTCTGCTGTTGCCTCCAAAGAGGACTCATGGACCCTATTTAAACCACCTCCAGTTTTTCCAGTAGACAATAGCAGTGCTAAAATAGTTCCTAAAATAAGTTATGCAAGCAAAGTTAAGGAAAACCTCAACAAAACTGTACAGAACTCTTCTGTGTCACCATCTTCATCTTCATCCTCTTCATCATCTGTTGGGGAAACTCAGACCCAATCTTCAAGTCGGTTATCCCAGGTCCCTATGTCAGCGCTGAAATCTGTTACTTCAGCCAGCTTTTCTAATGGACCTGTTTTAGCAGGGACTGATGCAAGTGTGTATTCTCCAGGGGGTCAGCCACTGCTAACTACTGCTGCTAATACGCTAACACCCACCTCTTCTGGGACTGATTCAGTTCTCCAGGACATGAGTCTGACTTCAGCAGCTGTTGAACAAATTAAGTCTAGCCTTTTTATCTACCCTTCAAATATGCAAGCTGTGCTGTTGAGCACAGCACAAGTGGATCTACCCTCTCAGACAGATCAGCAAAACCTGGGGGATATCTTCCAGAATCAGTGGGGTTTATCATTTATAAATGAACCCAGTGCTGGCCCTGAGACTGTTACTGGGAAGTCATCAGATAAAGTGATGGAGGTGACATTTCAAGGGGAATATCCTGCCACTTTGGTTTCACAGGGTGCTGAAATAATCCCCTCAGGAACTGAGCATCCTGTGTTTCCCAAGGCATATGAGCTGGAAAAACGGACTAGTCCTCAAGTTCTGGGTAGCATTCTAAAATCTGGGACTACTAGTGAGAGTGGAGCCTTATCCTTGGAACCCAGTCATATAGGTGACCTGCAAAAAGCAGACACCAGTAGTCAAGGTGCTTTAGTGTTTCTCTCAAAGGACTACGAGATAGAAAATCAAAATCCTCTGGCATCTCCTACGAACACTTTGTTAGGCTCCGCCAAAGAACAGAGATACCAGAGAGGCCTAGAAAGGGATGATAGCTGGGGTTCTTTTGACCTGAGGGCTGCTATTGTATATCACACTAAAGAAATGGAATCTGTTTGGAATTTGCAGAAGCAAGATCCCAAAAGGATAATCACTTACAATGAAGCCATGGATAGTCCAGATCAATGAAGGACCAGACTGCCTATTTGTAACCTTCCTGCAGCATTAGAGCCACCGTTCATGGGGGACACAAGGCTTTTATGCTCCTAGATCTTCAACGCAGCAGAGGAACCATAAGTAGAATCACAGGATAATATATACATATATATATATACAT