Transcript asmbl_72079

Sequence
Transcript Sequence for observation asmbl_72079 of TGE0000759:
GCGAGGGTTGGCCTCTCCCCTTCACAAATAATGGGAGGAACCTGGCAAGAGGGAGTTCTTTCCTTTCGCCGCTGCGGTCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTTGCCTCCAGTGTTCTGCGCTGTGGCAAAAAGAAGGTCTGGTTGGACCCCAATGAGACCAATGAAATTGCCAATGCCAACTCTCGTCAGCAGATTCGGAAGCTGATCAAAGATGGGCTGATCATCCGGAAGCCTGTGACTGTCCATTCCCGAGCACGATGCCGGAAAAACACCTTGGCCCGCAGAAAGGGCAGGCATATGGGCATAGGTAAGCGAAAGGGTACTGCCAATGCTCGAATGCCTGAGAAGGTAACCTGGATGAGGAGGATGAGAATCCTTCGCCGACTGCTCAGAAGATACCGTGAATCTAAGAAGATTGACCGCCACATGTATCACAGCCTGTACCTGAAAGTGAAGGGTAATGTGTTCAAAAACAAGCGGATTCTCATGGAACATATCCACAAGCTGAAGGCAGACAAGGCTCGCAAGAAACTTTTGGCTGACCAAGCTGAGGCCCGTAGATCTAAGACCAAGGAAGCACGCAAGCGCCGTGAAGAGCGGCTCCAGGCCAAGAAGGAGGAGATCATCAAGACTCTGTCCAAGGAAGAAGAGACCAAGAAATAAAGCACCACCTCTCTTACCTGTACATAGTGGCCTTGGCAATTATATAGATCAATCCTTCAATAAAATAGCTTTCATCTGCCTACCTCTCTGTTCTTCCAAAGTTTCTGGCTGTTTGATGAGTCTTCACTATTTAGAGGGCCAGAACTGAGCACACCGAGTTCTGAGATGCAGACCCTCTCCAGAGTGCCAGTTTTCATTCTTTCCTTGGCTCCTGGCCTCTGATAAGGCTCATGACCCCTCTGTCCATGGAAGAGACGGTTTTTTTACCTTGTTTTAGTGGGATGTGGGGCTTACTTTGAAGGGAGGGAAGGAATGACTTCTACTCAACTTCCGAAGTGCTGTGCTTTAAACTGCCTTTTACAGTAGAGCGTGAGTGGCATTTCAGAAGTGGTCTCAGATGTTGGTTGGGAACCAATAGTTGTGACATCAGCTGTCATTGTTTTAAAAACAAAAAACAGAATGCTTACACTTTTCAACTGGGCACTGGGGTCCAAGGTTGAAATCTGCCCTAGAACTCAAGGACAGTGAGAGTTTCAACCACCTCCAGTCAAGCTAATGACACCTGGACTTCACTGACTGCTACCTATGCTTTCTCTAAACAACTTTATTGAAGCTGTCATTTTGAACATTCCAGTTTCTAAACCTTTATGTCCTATCAGGGTTTTGTTTTTTGTTTTCTGTTTTACACTGATAGATTACAAAGAGAAAGGCTTTTCTCAGAAATTGGAATAAAG