Transcript asmbl_72052

Sequence
Transcript Sequence for observation asmbl_72052 of TGE0007325:
CCTGGCGTTTCCCAGAAGGCCCAGCGCTGGGAAGGGGTTTGCAGCTGCTCCGTCATCGTGCGGCCCGACGCGAGCCCGCGCTCGTGTGCAGGCCCGGCTTGGTTCCTGGTCTCTGGTGCGAGGGTTCACACGAGGCCCCGGCCTCGGACCCCGGACTAGGCCGCGACCCCGGGCGCCATGAAGCAGGAGGGCTCGGCGCGGCGCCGAGGGGCGGACAAGGCGAAACCGCCACCCGGCGGAGGGGAACAAGAACCACCGCCACCCCCGGCCCCCCAGGATGTGGAGATGAAAGAGGAGGCGGTGGCAGGTGGCGGATCAACGGGGGAGGCTGACGGCAAGACGGCGGCGGCGGCGGCTGAGCACTCCCAGCGAGAGCTGGACACCGTCACCTTGGAGGATATCAAGGAGCATGTGAAACAGCTGGAGAAGGCAGTTTCAGGCAAGGAGCCTCGATTTGTTCTGAGGGCCCTGCGGATGCTGCCTTCCACATCACGCCGCCTCAACCACTATGTTCTGTATAAGGCTGTGCATGGCTTCTTCACCTCAAATAATGCCACTCGGGACTTCTTGCTACCCTTCCTGGAAGAGCCCATGGACACAGAAGCTGATTTACAGTTCCGTCCCCGAACAGGAAAAGCTGCATCAGCACCGCTGCTGCCTGAAGTGGAAGCCTATCTGCAGCTCCTCATGGTCATCTTCCTGATGAACAGCAAGCGCTACAAAGAGGCACAGAAGATCTCTGATGATCTGATGCAGAAGATCAGCACTCAGAACCGCCGGGCCCTGGACCTTGTGGCTGCAAAGTGTTACTACTACCACGCCCGGATCTATGAGTTCCTGGACAAGCTGGATGTGGTGCGCAGCTTCTTGCATGCACGGCTCCGGACAGCCACCCTTCGGCATGACGCAGACGGGCAGGCCACCCTGCTTAACCTTCTGCTGCGGAACTACCTACACTACAACTTGTACGACCAGGCTGAGAAGCTGGTGTCCAAGTCCGTGTTCCCTGAGCAGGCCAACAACAATGAGTGGGCAAGGTACCTCTACTACACAGGGCGGATCAAAGCCATCCAGTTGGAGTACTCAGAGGCCCGGAGAACAATGACCAATGCCCTTCGCAAGGCCCCTCAGCACACAGCTGTCGGCTTCAAACAGACTGTGCACAAGCTTCTTATTGTGGTGGAGCTGTTGCTGGGGGAGATCCCGGACCGACTGCAGTTCCGTCAGCCATCCCTCAAGCGCTCGCTCATGCCCTACTTCCTTTTGACCCAAGCTGTCAGGACAGGAAACCTAGCCAAGTTCAACCAGGTCCTGGATCAGTTTGGGGAGAAGTTTCAAGCAGATGGGACCTACACCCTAATCATCCGACTGCGGCACAACGTCATTAAGACAGGTGTGCGCATGATCAGTCTCTCCTATTCCCGAATCTCCCTGGCCGACATCGCCCAGAAGCTGCAACTAGATAGCCCAGAGGATGCAGAGTTCATTGTTGCCAAGGCCATCCGGGATGGCGTCATTGAGGCCAGCATCAACCATGAGAAGGGCTACGTGCAGTCCAAGGAAATGATTGATATCTATTCCACGCGTGAGCCCCAGCTCGCCTTCCACCAGCGCATCTCCTTCTGCCTAGACATCCACAACATGTCTGTCAAGGCCATGAGGTTTCCTCCCAAATCATACAACAAGGACTTGGAATCTGCAGAGGAACGGCGTGAGCGAGAGCAGCAAGACTTGGAGTTTGCCAAAGAGATGGCAGAAGATGATGATGACAGCTTCCCTTGAGCTGGGGGGCTGGGGAGGGGTGGGGTGAGTGGGGACTGGCTCTTTATCTTTCCCCTCAGGGGTCCCATGCCCAGGGAACTGGCCCTTTTTCCCACACACAGCTCACAGACTGCATATGTGCTGGGGGCGGGCGGGGTGAAGGGTGTAGAGAGCCAGCCACCCCCACCTCACCTCAGGGCCCCTCCCCAGCCGGTGATTTAGCACACAGTGGTCAAGAGGGCGGGCAGACAGCCTCCCCAGGGCAGGGTCCTGGCTAGTGGTGTGGGCAGCAAGATGGGAGGGAAAAGCCCTGTGCTCTCCTCCAGGGAGTAGGGGACTGGAACTGGGACATGTGTCGGGTTGTATGTTTTTTGAAGCTTCAATTATGATTTTTAAA