Transcript asmbl_72035

Sequence
Transcript Sequence for observation asmbl_72035 of TGE0007322:
GCCCCAGTCACTGAGCCGCCGCCGAGGACTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTTCCCGACGCTCCGTCCCCCCTGCCCGCCTTCTCCCGCCGCCGCCTTCCGCAGGCCGTTTCCACCGAGGAAAAGGAATCGTATCGTATGTCCGCTATCCAGAACCTCCACTCTTTCGACCCCTTTGCTGATGCAAGTAAGGGTGATGATCTGCTTCCTGCTGGCACTGAGGATTATATCCATATAAGAATTCAACAGAGAAACGGCAGGAAGACCCTTACTACTGTCCAAGGGATCGCTGATGATTACGATAAAAAGAAACTAGTGAAGGCGTTTAAGAAGAAATTTGCCTGCAATGGTACTGTAATTGAGCATCCAGAATATGGAGAAGTAATTCAGCTACAGGGTGACCAGCGCAAGAACATATGCCAGTTCCTCGTAGAGATTGGTCTGGCTAAGGACGACCAGCTGAAGGTTCATGGGTTTTAAGTGCTTTTTGGCTCACTGAAGCTTAAGTGAGGATTTCCTTGCAATGAGTAGAATTTCCCTTCTGTCCCTTGTCACAAGTTTAAAAACCTCACAGCTTGTATAATGTAACCATTTGGGGTCTGCTTTTAACTTGGACTAGTGTAACTCCTTCATGCAATAAACTGAAAAGAGCCATGCTGTCTAGTCTTGAAGTCCCTCATTTAAACAGAGGTCAAGCAGTAGGCACCCGGCAGTGTCCAGCCTGAAACAAAGCAATAACGTGATGTTTCGGCCAAGCTCAGAGCCCCAAGATCACAGATGGCTATGTCCAGCCAGAAGCTCCTCGGCTCTCCCTCTACAGAATTCCCTGCCCTAAGAGAATGTCACCACCTGAACAGCCTTCGGTGAAGCTTGAGAGAGGATGGGGTAAGGCAGCAACAGCAGCTGTGCCACTAGAGGGAGCCTCCAGTAGTCAAAGATCCCTTGGTGTCTCCAATCTGACCAGGTGGGTGGAGCTTCAGGCAGTCACCTTCCCGCTGTTGAGGTGATAAGGACACCTGGCTTGCCACCAAGGTGTTTTTGATAAGAAATGTCCTAACCGATGTCCAAACACAGAATGTGAGGCCAACCTTCTATCAGAGTTAAACTTTTGACAAGGGAACAAGTTTCAAACTGATGTGTCATGTAGCTAGCTGTAGAGCTTGCAGTTTACTAGCAAGAGCTGCCCAATGCCATGTGAAGTAACAGATTTTTGGTTTTTTCCCTTCAGTTTTAATGTTATGTAATGTATTTAAACCCTTATTTAAATAAAACTTGTTTTCAGAAA