Transcript asmbl_13506

Sequence
Transcript Sequence for observation asmbl_13506 of TGE0000166:
GGGAGGAGGGCGGCGAAAGGGCCCTACGTGCTGACGCTAATTGTATATGAGCGCGAGCGGCGGGCTCTTGGGTCTTTTTTAGCGCCATCTGCTCGCGGCGCCGCCTCCTGCTCCTCCCGCTGCTGCTGCCGCTGCCGCCCTGAGTCACTGCCTGCGCAGCTCCGGCCGCCTGGCTCCCCATACTAGTCGCCGATATTTGGAGTTCTTACAACATGGCAGACATTGACAACAAAGAACAGTCTGAACTTGATCAAGATTTGGATGATGTTGAAGAAGTAGAAGAAGAGGAAACTGGTGAAGAAACAAAACTCAAAGCACGTCAGCTAACTGTTCAGATGATGCAAAATCCTCAGATTCTTGCAGCCCTTCAAGAAAGACTTGATGGTCTGGTAGAAACACCAACAGGATACATTGAAAGCCTGCCTAGGGTAGTTAAAAGACGAGTGAATGCTCTCAAAAACCTGCAAGTTAAATGTGCACAGATAGAAGCCAAATTCTATGAGGAAGTTCACGATCTTGAAAGGAAGTATGCTGTTCTCTATCAGCCTCTATTTGATAAGCGATTTGAAATTATTAATGCAATTTATGAACCTACGGAAGAAGAATGTGAATGGAAACCAGATGAAGAAGATGAGATTTCGGAGGAATTGAAAGAAAAGGCCAAGATTGAAGATGAGAAAAAAGATGAAGAAAAAGAAGACCCCAAAGGAATTCCTGAATTTTGGTTAACTGTTTTTAAGAATGTTGACTTGCTCAGTGATATGGTTCAGGAACACGATGAACCTATTCTGAAGCACTTGAAAGATATTAAAGTGAAGTTCTCAGATGCTGGCCAGCCTATGAGTTTTGTCTTAGAATTTCACTTTGAACCCAATGAATATTTTACAAATGAAGTGCTGACAAAGACATACAGGATGAGGTCAGAACCAGATGATTCTGATCCCTTTTCTTTTGATGGACCAGAAATTATGGGTTGTACAGGGTGCCAGATAGATTGGAAAAAAGGAAAGAATGTCACTTTGAAAACTATTAAGAAGAAGCAGAAACACAAGGGACGTGGGACAGTTCGTACTGTGACTAAAACAGTTTCCAATGACTCTTTCTTTAACTTTTTTGCCCCTCCTGAAGTTCCTGAGAGTGGAGATCTGGATGATGATGCTGAAGCTATCCTTGCTGCAGACTTCGAAATTGGTCACTTTTTACGTGAGCGTATAATCCCAAGATCAGTGTTATATTTTACTGGAGAAGCTATTGAAGATGATGATGATGATTATGATGAAGAAGGTGAAGAAGCGGATGAGGTAATGTTTACCAAATGAGCAAATAATTCTCTGTGGTTAACACATTGAGAAGCAAATTGAATGACTTATGTATTCCTTTGCTATAATCATTCTGTGATTTGGGATAAAAACATTTTGGAAAACATGATTTTAGAATTCTACAGCCAAACAATGTATGTATAAGGTTTCAATAAATAAATTGCAAAACTCAGCAACATTTTTTTATTTCAAATAATTTTGTTCTGCTGCAGGGTTATCAGCTCTTTGAAGAAGTCAAAAGCTGCAGTAAACTTTTCCAACGTTGGCTGCAGTAACTATTTTCAATAAAAGCTGTCTGGATGTCTCAAGTTGTGTTGGGAAATTTTTCATATTAGAAGCTTTCAAATTAAATTGTATTATCATCAAAGTCTGTAATCATGAAAATCTGTTGATCCGTAGAGTAACTTGTATTAAATTTTC