Transcript asmbl_71950

Sequence
Transcript Sequence for observation asmbl_71950 of TGE0007304:
AGGTTGACTTTTCACCACACTGAAACCATTAGGAAAAATCCTTGTGGTTAACAGCAGAGGCTTCAGAGTGTAACCTGTACTGGGGCCTAGAAATTATTTTAAATGGCGACTGATACGTCTCAAGGTGAACTCGTCCATCCTAAGGCACTCCCACTTATAGTAGGAGCTCAGCTGATCCACGCGGACAAGTTAGGTGAGAAGGTGGAAGAGAGCGCCATGCCGATTCGTCGAGCTGTGAATTCTACCCGGGAAACTCCTCCCAAAAACAAGCTTGCTGAAGGGGAGGAAGGAAAGCCAGAACCAGACGTAAGTTCAGAGGAATCTATCTCTACCGTAGAAGAACAAGAGAATGAAACTCCACCTGCTACATCTAGTGAGGCAGAGCAGCCAAAGGGGGAACCTGAGAATGAAGAGAAGGAAGAAAACAAGTCTTCTGAGGAAACCAAAAAGGATGAGAAAGATCAGTCTAAAGAAAAGGAGAAGAAAGTGAAAAAAACAATACCTTCCTGGGCTACCCTTTCTGCCAGCCAGCTAGCCAGGGCCCAGAAACAAACACCGATGGCTTCCTCCCCACGTCCCAAGATGGATGCAATCCTAACGGAGGCCATTAAGGCGTGCTTCCAGAAGAGTGGTGCATCAGTTGTTGCTATTCGAAAATACATCATCCATAAGTACCCTTCTCTGGAGCTGGAGAGAAGAGGCTACCTCCTTAAACAAGCACTGAAAAGAGAATTAAATAGAGGTGTCATCAAACAGGTAAAAGGAAAAGGTGCTTCTGGGAGTTTTGTGGTGGTCCAGAAATCAAGAAAAACCCCACAGAAATCTAGAAACAGAAAGGACAGGAGCTCTGCAGTGGATCCAGAACCACAAGTAAAATTGGAAGATATCCTCCCATTGGCCTTTACTCGCCTTTGTGAACCTAAAGAAGCTTCCTACAGTCTCATCAGAAAATACGTGTCTCAGTATTACCCTAAACTTAGAGTGGACATCAGGCCTCAGCTGTTGAAGAATGCTCTGCAAAGAGCAGTAGAGAGAGGCCAGTTAGAACAAATAACTGGCAAAGGAGCTTCTGGAACATTCCAGCTGAAGAAATCAGGGGAGAAACCCCTGCTTGGTGGAAGCCTGATGGAATATGCAATCTTGTCTGCCATTGCTGCCATGAATGAGCCGAAGACCTGCTCCACCACTGCTCTGAAGAAGTATGTCCTGGAGAACCACCCAGGGACCAATTCTAACTATCAAATGCATCTGCTAAAAAAAACCTTGCAGAAATGCGAAAAGAATGGGTGGATGGAACAGATCTCTGGTAAAGGATTCAGTGGCACCTTCCAGCTCTGTTTTCCCTATTACCCCAGCCCAGGAGTTCTATTTCCAAAGAAAGAGCCAGATGATTCTAAAGATGAGGATGAAGATGAAGATGACTCATCAGAAGAAGACTCTGAGGATGAAGAGCCTCCACCTAAGAGGTTACAAAAGAAAACCCCAGCCAAGTCATCAGGGAAGGCTGCATCCATGAAGCAGAGAGGGTCCAAGCCTCTACCGAAAGTCCCAGCTGCCCAGCGGGGGAAAGCTAGGCCCCTGCCCAAGAAAGCCTCTCCTAAGGCCAAAACTCCTGCCAAGAAAGCTAGACCCTCACCCTCAGTCATCAAGAAACCTAGTGGTGGCTCTTCAAAGAAGCCTGCGGCCAGTGTGAGAAAGGAAGTGAAATTGCCTGGCAAGGGCAAATCTACCATGAAGAAATCTTTCAAAGCAAAAAAGTAAATTTTATAGGGAAAAAAGGGTATCATGATGAAATTTAAAATCTTATTTTATAAGGTCAGTGTGCATTTGTTTTAGTTTTGATGCTTTTAAAATTATATTTTTTCCTTCCCCTCAGAACATTGTGAGGAGGGAATATAAATAAACCAGTTTAGGCATTCGTTAGCTTTTGGCACTATTCTTGGTGTCTGCCCCTTCCCTCGGTCATTTCATTTTCTGCGATAATTCTGGACTTGCCTGAACTGTATAATCTATACATGTCTATTTTTCTCCCTCCACCCCAACCCTCTTTTTGTTTGTTTGTTTGTTTGT