Transcript asmbl_71831

Sequence
Transcript Sequence for observation asmbl_71831 of TGE0014121:
AAATATGATCCAAGGTGTGGGTGTGAAATCTCTATGATTAGCAACAGCTGTTCTCCAGATGCTCGGTCTGCAGACTGGAATTATGGCTTCCTTCCCAAGCTACCTGCCATTGGAGGAAACGAAGGCGTTGGACAGGTGGTCGCAGTGGGCAGCAGTGTGACTAGGGTGAAGCCAGGAGACTGGGTGATTCTAGCACATGCCGGTTTGGGAACCTGGCGGACCGAGGCTGTGTTCAGCGAGGAAGCACTGATCAGAGTTCCGAGTGACATCCCTCTTCAAACTGCTGCCACCCTGAGTGTCAATCCCTGCACAGCCTACAGGATGTTGATGGACTTTGAGCAGCTGCAGCCAGGGGATTCTGTCATCCAGAATGCATCCAACAGTGGAGTAGGGCAAGCAGTCATCCAGATCGCCGCAGCCCTGGGCCTGAGGACCATCAATGTGGTCCGAGACAGACCTGACATCCATAGGCTGACTGACAGACTGAAGAATCTAGGGGCTGAGTATGTAATCACAGAAGAAGAGCTAAGAAAACTTGAGCTGAAAAACTTCTTTAAGGATGTGCCCCGGCCCCGGCTTGCTCTCAACTGCGTCGGTGGGAAAAGCTCCACCGAGCTGCTGCAGCGCTTGGCGCCCGGAGGAACCATGGTGACCTACGGGGGCATGGCCAAGCAGCCCGTCATCGCTTCTGTGAGCGTGTTCATTTTTAAAGATGTCAAACTTCGGGGCTTTTGGCTATCCCAGTGGAAGAAGGACCACAGTACAGACCATTTTAAGGAGCTGATCCTTACACTGTGCCACCTCGTCCACCAAGGCAAGCTCACAGCCCCCACCTGCTCCGAGGTCCCACTGCAGGACTACAACCATGCCTTGGAAACCGCAATGCATCCCTTCACATCGTCAAAGCAGATTTTCATCATGTGATAATAATCCCAGAGGAGCCAGAGCAAAGTGCGGGGCAGGGGGCAGAAGGGTGTGGGGGCGGGACGGGTCAGCAGG