Transcript asmbl_13505

Sequence
Transcript Sequence for observation asmbl_13505 of TGE0000165:
GGGAGGAGGGCGGCGAAAGGGCCCTACGTGCTGACGCTAATTGTATATGAGCGCGAGCGGCGGGCTCTTGGGTCTTTTTTAGCGCCATCTGCTCGCGGCGCCGCCTCCTGCTCCTCCCGCTGCTGCTGCCGCTGCCGCCCTGAGTCACTGCCTGCGCAGCTCCGGCCGCCTGGCTCCCCATACTAGTCGCCGATATTTGGAGTTCTTACAACATGGCAGACATTGACAACCTGCCTAGGGTAGTTAAAAGACGAGTGAATGCTCTCAAAAACCTGCAAGTTAAATGTGCACAGATAGAAGCCAAATTCTATGAGGAAGTTCACGATCTTGAAAGGAAGTATGCTGTTCTCTATCAGCCTCTATTTGATAAGCGATTTGAAATTATTAATGCAATTTATGAACCTACGGAAGAAGAATGTGAATGGAAACCAGATGAAGAAGATGAGATTTCGGAGGAATTGAAAGAAAAGGCCAAGATTGAAGATGAGAAAAAAGATGAAGAAAAAGAAGACCCCAAAGGAATTCCTGAATTTTGGTTAACTGTTTTTAAGAATGTTGACTTGCTCAGTGATATGGTTCAGGAACACGATGAACCTATTCTGAAGCACTTGAAAGATATTAAAGTGAAGTTCTCAGATGCTGGCCAGCCTATGAGTTTTGTCTTAGAATTTCACTTTGAACCCAATGAATATTTTACAAATGAAGTGCTGACAAAGACATACAGGATGAGGTCAGAACCAGATGATTCTGATCCCTTTTCTTTTGATGGACCAGAAATTATGGGTTGTACAGGGTGCCAGATAGATTGGAAAAAAGGAAAGAATGTCACTTTGAAAACTATTAAGAAGAAGCAGAAACACAAGGGACGTGGGACAGTTCGTACTGTGACTAAAACAGTTTCCAATGACTCTTTCTTTAACTTTTTTGCCCCTCCTGAAGTTCCTGAGAGTGGAGATCTGGATGATGATGCTGAAGCTATCCTTGCTGCAGACTTCGAAATTGGTCACTTTTTACGTGAGCGTATAATCCCAAGATCAGTGTTATATTTTACTGGAGAAGCTATTGAAGATGATGATGATGATTATGATGAAGAAGGTGAAGAAGCGGATGAGGTAATGTTTACCAAATGAGCAAATAATTCTCTGTGGTTAACACATTGAGAAGCAAATTGAATGACTTATGTATTCCTTTGCTATAATCATTCTGTGATTTGGGATAAAAACATTTTGGAAAACATGATTTTAGAATTCTACAGCCAAACAATGTATGTATAAGGTTTCAATAAATAAATTGCAAAACTCAGCAACATTTTTTTATTTCAAATAATTTTGTTCTGCTGCAGGGTTATCAGCTCTTTGAAGAAGTCAAAAGCTGCAGTAAACTTTTCCAACGTTGGCTGCAGTAACTATTTTCAATAAAAGCTGTCTGGATGTCTCAAGTTGTGTTGGGAAATTTTTCATATTAGAAGCTTTCAAATTAAATTGTATTATCATCAAAGTCTGTAATCATGAAAATCTGTTGATCCGTAGAGTAACTTGTATTAAATTTTC