Transcript asmbl_71487

Sequence
Transcript Sequence for observation asmbl_71487 of TGE0007233:
CGCCGTCGTAGAGCGGGGACGCGGGGCGCGCTGTCGGGCGGGGGCGAGGTTCGGGCCGGTTGTGCCGTTGCGAGACTGCAGCTGCGATCGCTGCGGTGGGCCCAGAATTGTATCCTGACCGTAAATCGGAGAAGCCAGCAGCACTGCCAGTGTTCCTTTGAGGTAGTGTCTGGGATCCGGTGCAAGTTGAATCATTGTTCAAATAAGGTGTAATTGAAAAGTGACTGACCCTCTCTTCAGAGATGTCAAAAACAAACAAATCCAAGTCTGGATCTCGTTCTTCTCGCTCGAGGTCTGCATCAAGATCTCGTTCTCGTTCATTTTCGAAGTCTCGATCTCGAAGTCGATCTGTCTCTCGTTCAAGGAAGCGCAGGCTGAGTTCTAGGTCTCGTTCCAGATCATATTCTCCAGCTCATAACAGAGAGAGGAATCATCCAAGAGTATATCAGAATCGGGATTTCCGAGGGCACAACAGAGGTTATAGAAGGCCTTATTATTTCCGTGGGCGCAACAGAGGCTTTTATCCGTGGGGCCAGTATAACCGAGGAGGTTATGGAAACTACCGCTCAAATTGGCAGAATTACCGGCAAGCATACAGTCCTCGTCGGGGCCGTTCCCGATCCCGGTCCCCAAAGAGAAGGTCCCCTTCGCCACGGTCCAGGAGCCATTCTAGAAACTCCGATAAGTCTTCTTCTGACAGGTCAAGGCGCTCCTCATCCTCTCGTTCTTCCTCCAACCACAGCCGAGTTGAATCTTCTAAGCGCAAATCTGCAAAGGAGAAAAAGTCCTCTTCCAAGGATAGCCGGCCGTCTCAGGCTGCTGGGGAAAACCAGGGAGATGAAGCCAAGGAGCAGACGTTCTCTGGAGGCACTTCTCAAGATTCGAAAGCATCTGAAAGCTCTAAGCCATGGGCAGATGCCAGCACATACAGTGCTGGTTCTGCATCACGGGCCTCGGCAGTTTCCGAGCTGAGTCCCCGGGAGCGAAGCCCTGCTCTGAAAAGCCCCCTCCAGTCTGTGGTGGTGAGACGGCGGTCTCCCCGTCCCAGCCCTGTGCCCAAACCTAGCCCTCCACTTTCCAGCACATCCCAGATGGGTTCAGCTCTGCAGAGTGGTTCTGGGTACCAGGCTGGGACACACCAAGGTCAATTTGACCATGGCTCTGGGTCCTTGAGTCCATCCAAAAAGAGCCCTGTGGGTAAGAGTCCACCAGCCACTGGCTCCACATATGGCTCGTCTCAGAAAGAGGAGGCCGCTGCTCCAGGAGGAGCAGCCTATACAAAGAGGTATCTAGATGAACAGAAGACAGAGAATGGAAAAGATAAGGAACAGAAACAAACAAATACTGATAAAGAGAAAATGAAAGAGAAAGGGAGCTTCTCTGACACAGGCTTGGGTGATTCGAAAATGAAATCTGATCTGTTTGCTCCCAAAACTGATTCTGAGAAGCCTTTTCGGGGTAGCCAGTCTCCCAAAAGATATAAGCTCCGAGATGACTTTGAGAAGAAGATGGCTGACTTCCATAAGGAGGAGATGGATGATCAAGACAAGGACAAAGCTAAAGGAAGGAAGGAATCTGAGTTTGATGATGAACCCAAATTTATGTCGAAAGTCATCGCAGGTGCAAACAAAAACCAGGAGGAGGAGAAGTCAGGCAAATGGGAGGGCCTGGTATATGCACCCCCAGGGAAGGAAAAGCAGAGGAAAACGGAGGAGCTGGAGGAGGAGTCTTTCTCAGAGAGATCCAAAAAGGAAGATCGGGGAGGGCCCAAGAGAACCGAAAGTGGGCACAGGGGGTTTGTGCCTGAAAAGAATTTCCGAGTGACCGCTTACAAAGCAGCCCAGGAGAAAAGTTCATCTCCTCCCCCAAGAAAGACCTCGGAGAGCCGAGAGAAGCTGGGAGCCAAAGGAGACTTTTCCACAGGGAAGTCATCCTTTTCCATTACTCGAGAGGCCCAGGTCAATGTCCGGATGGATTCTTTTGATGAAGACCTTGCAAGACCCAGTGGGTTATTGGCCCAGGAACGCAAGCTTTGTCGGGATCTAGTCCATAGTAACAAAAAGGAACAGGAATTTCGTTCCATTTTCCAGCACATACAGTCAGCTCAGTCTCAGCGGAGCCCCTCAGAACTCTTTGCCCAGCACATAGTGACCATTGTTCACCATGTAAAAGAGCATCACTTTGGGTCCTCAGGAATGACATTGCATGAACGCTTTACTAAATACCTAAAGAGAGGAACTGAGCAGGAGGCAGCTAAAAACAAGAAAAGCCCAGAGATACACAGGAGGATAGACATTTCCCCCAGTACATTCAGAAAACATGGTTTGGCTCATGATGAAATGAAAAGCCCTCGGGAACCTGGCTACAAGGATGGGCATAATTCTAAAAATGAACTACAAAGGGTTAATTTTTATTAAATGTATCAACAACCTTTGTGAAGTGGTTAGAATATGGTAAATGACCCCAAAGTCTATTGAGGTGAGCTTGAGAAAAAAAAGAGAGGAGTTTTGGAACAAGTGCCCATGATGAGAGAAGAAACTTTTTGTGATATTTTTCTGCTTGTAAGTATTATCAAATCAACTATATACATGCACTATTTCCAACCATGATTTCAAAAAGACATGCATGTCAGAGGAGAGTGAAATATTCATATCTTAACTTAATAGACTGTTTTAAACAGTTAGTCCAGTTTTTTTCTAACATTGTACCATATCTATCATCTGTTGGTTACTGCTGCTTTAAAGCTAAACATTACTTTGATAGCCCAGCTACATTTGCAATGATGTGCACGTAAACACTGTTATTAAGAGGTT