Transcript asmbl_71486

Sequence
Transcript Sequence for observation asmbl_71486 of TGE0007233:
CGCCGTCGTAGAGCGGGGACGCGGGGCGCGCTGTCGGGCGGGGGCGAGGTTCGGGCCGGTTGTGCCGTTGCGAGACTGCAGCTGCGATCGCTGCGGTGGGCCCAGAATTGTATCCTGACCGTAAATCGGAGAAGCCAGCAGCACTGCCAGTGTTCCTTTGAGGTAGTGTCTGGGATCCGGTGCAAGTTGAATCATTGTTCAAATAAGGTGTAATTGAAAAGTGACTGACCCTCTCTTCAGAGATGTCAAAAACAAACAAATCCAAGTCTGGATCTCGTTCTTCTCGCTCGAGGTCTGCATCAAGATCTCGTTCTCGTTCATTTTCGAAGTCTCGATCTCGAAGTCGATCTGTCTCTCGTTCAAGGAAGCGCAGGCTGAGTTCTAGGTCTCGTTCCAGATCATATTCTCCAGCTCATAACAGAGAGAGGAATCATCCAAGAGTATATCAGAATCGGGATTTCCGAGGGCACAACAGAGGTTATAGAAGGCCTTATTATTTCCGTGGGCGCAACAGAGGCTTTTATCCGTGGGGCCAGTATAACCGAGGAGGTTATGGAAACTACCGCTCAAATTGGCAGAATTACCGGCAAGCATACAGTCCTCGTCGGGGCCGTTCCCGATCCCGGTCCCCAAAGAGAAGGTCCCCTTCGCCACGGTCCAGGAGCCATTCTAGAAACTCCGATAAGTCTTCTTCTGACAGGTCAAGGCGCTCCTCATCCTCTCGTTCTTCCTCCAACCACAGCCGAGTTGAATCTTCTAAGCGCAAATCTGCAAAGGAGAAAAAGTCCTCTTCCAAGGATAGCCGGCCGTCTCAGGCTGCTGGGGAAAACCAGGGAGATGAAGCCAAGGAGCAGACGTTCTCTGGAGGCACTTCTCAAGATTCGAAAGCATCTGAAAGCTCTAAGCCATGGGCAGATGCCAGCACATACAGTGCTGGTTCTGCATCACGGGCCTCGGCAGTTTCCGAGCTGAGTCCCCGGGAGCGAAGCCCTGCTCTGAAAAGCCCCCTCCAGTCTGTGGTGGTGAGACGGCGGTCTCCCCGTCCCAGCCCTGTGCCCAAACCTAGCCCTCCACTTTCCAGCACATCCCAGATGGGTTCAGCTCTGCAGAGTGGTTCTGGGTACCAGGCTGGGACACACCAAGGTCAATTTGACCATGGCTCTGGGTCCTTGAGTCCATCCAAAAAGAGCCCTGTGGGTAAGAGTCCACCAGCCACTGGCTCCACATATGGCTCGTCTCAGAAAGAGGAGGCCGCTGCTCCAGGAGGAGCAGCCTATACAAAGAGGTATCTAGATGAACAGAAGACAGAGAATGGAAAAGATAAGGAACAGAAACAAACAAATACTGATAAAGAGAAAATGAAAGAGAAAGGGAGCTTCTCTGACACAGGCTTGGGTGATTCGAAAATGAAATCTGATCTGTTTGCTCCCAAAACTGATTCTGAGAAGCCTTTTCGGGGTAGCCAGTCTCCCAAAAGATATAAGCTCCGAGATGACTTTGAGAAGAAGATGGCTGACTTCCATAAGGAGGAGATGGATGATCAAGACAAGGACAAAGCTAAAGGAAGGAAGGAATCTGAGTTTGATGATGAACCCAAATTTATGTCGAAAGTCATCGCAGGTGCAAACAAAAACCAGGAGGAGGAGAAGTCAGGCAAATGGGAGGGCCTGGTATATGCACCCCCAGGGAAGGAAAAGCAGAGGAAAACGGAGGAGCTGGAGGAGGAGTCTTTCTCAGAGAGATCCAAAAAGGAAGATCGGGGAGGGCCCAAGAGAACCGAAAGTGGGCACAGGGGGTTTGTGCCTGAAAAGAATTTCCGAGTGACCGCTTACAAAGCAGCCCAGGAGAAAAGTTCATCTCCTCCCCCAAGAAAGACCTCGGAGAGCCGAGAGAAGCTGGGAGCCAAAGGAGACTTTTCCACAGGGAAGTCATCCTTTTCCATTACTCGAGAGGCCCAGGTCAATGTCCGGATGGATTCTTTTGATGAAGACCTTGCAAGACCCAGTGGGTTATTGGCCCAGGAACGCAAGCTTTGTCGGGATCTAGTCCATAGTAACAAAAAGGAACAGGAATTTCGTTCCATTTTCCAGCACATACAGTCAGCTCAGTCTCAGCGGAGCCCCTCAGAACTCTTTGCCCAGCACATAGTGACCATTGTTCACCATGTAAAAGAGCATCACTTTGGGTCCTCAGGAATGACATTGCATGAACGCTTTACTAAATACCTAAAGAGAGGAACTGAGCAGGAGGCAGCTAAAAACAAGAAAAGCCCAGAGATACACAGGAGGATAGACATTTCCCCCAGTACATTCAGAAAACATGGTTTGGCTCATGATGAAATGAAAAGCCCTCGGGAACCTGGCTACAAGGATGGGCATAATTCTAAAAATGAACTACAAAGGGTTAATTTTTATTAAATGTATCAACAACCTTTGTGAAGTGGTTAGAATATGGTAAATGACCCCAAAGTCTATTGAGGTGAGCTTGAGAAAAAAAAGAGAGGAGTTTTGGAACAAGTGCCCATGATGAGAGAAGAAACTTTTTGTGATATTTTTCTGCTTGCTGAGGGAAAATACAAAGATGATCCTGTTGATCTCCGCCTTGATATTGAACGGCGTAAAAAACATAAGGAGAGAGATCTTAAACGAGGCAAATCAAGAGAATCGGTGGATTCCAGAGACTCAAGCCACTCGAGGGAAAGATCAGCTGAGAAAACCGAGAAACCCCATAAAGGATCAAAGAAGCAGAAGAAGCACCGGAGAGCACGAGACCGGTCCAGGTCATCATCCTCTTCCTCCCAGTCATCCCACTCCTACAAAGCGGAGGAGTACACTGAAGAGACGGAGGAGAGAGAGGAGAGCACCACGGGCTTTGACAAATCGAGACTGGGGACCAAAGACTTCGTGGGTCCAAGTGAAAGAGGCAGAGCTCGAGGGGCCTTTCAATTTCGAGCCAGAGGGAGAGGCTGGGGCAGAGGCAACTACTCTGGCAACAACAACAGCAGCAGCAACAATGATTTTCAAAAGAGAAACCGGGAGGAGGAATGGGACCCTGAGTACACACCGAAAAGCAAGAAGTATTACCTGCATGACGACCGGGAAGGAGAAGGCAGTGAGAAGTGGGTGAGCCGGGGCCGTGGCCGAGGAGCCTTTCCCCGAGGTCGAGGCCGGTTCATGTTCCGGAAATCCAGCACCAGCCCTAAATGGGCCCATGACAAGTTCAGTGGGGAAGAAGGCGAGATTGAAGATGACGAGAGTGGGACAGAGAACCGAGAAGAGAAGGACAATTTACAGCCCACCACTGAGTAGGGGCCACTCTCATGAGAACCCTTGCCCAGGGGAACAGAGGCGCTGGGAAGATGGCTGGTGAAAAGCTAAACAGATGAGCCCCAAGAAGATTCTGATGAGCCCCAACCCTACCCCCCACCAGCCATGCAGAATCCTACTACAGCCAAAAGCATCCTTGGCGCTGTGTCCCACTGGACAGAGGTGGCCGGCCATGGAGCCTGGGGTCAGGCCCAGCTCTTGAGCAGAATACAACACTTTGGGCTTTAGCTGTGTTTCTCATTTGTTGTTGGTGTGTGGGGTGGGG