Transcript asmbl_70446

Sequence
Transcript Sequence for observation asmbl_70446 of TGE0007200:
TGCAGACGCGAGCACAGGTTTATAAGCGCCACGCAGGCCACGGTCCCTTCTTTTGGAGGAAGACGCGGTAGCAGCTTCAGCTGCGTTTCGTCTTGCTCGCTGTTGCTCCTGACTCACCGCTGTTCGCTCTCGTGGAGGAACAAGTCGGTCAGGAAGCCGCGCTGCAGCCATGGCCTTTAAAGATACCGGAAAGACGCCCGTGGAACCAGAGGTGGCGATTCACCGAATTAGAATTACTTTGACCAGCCGCAACGTAAAATCTTTGGAGAAGGTGTGTGCTGATTTGATCAGAGGTGCGAAGGACAAGAATCTCAAAGTGAAAGGACCAGTTCGGATGCCCACCAAGACTCTGAGAATCACTACAAGAAAAACTCCCTGTGGAGAAGGTTCTAAGACTTGGGATCGTTTTCAGATGAGGATCCACAAGCGACTCATTGACTTGCACAGCCCTTCTGAGATTGTTAAGCAGATTACTTCCATCAGTATTGAGCCAGGAGTTGAGGTTGAAGTCACCATTGCAGATGCTTAAATCAGACTTTTTAATAAATTGACTATCAGTTAAATTTTGTTGACTTTTATTTGCAGTAATGGCACATTTTAAGACTATAAATTTAGACTGAATTTACTTTCAAGTAGAATAATCAAAATTAGTTGGATATGCTGTGGTAACCTGTCCTGTTTTCATTATATTCTGTTGTAGAGTCTGCTAAACCAGTTTATACTTGGAATCACAGGACAGCTGGGTTCTGTTAACTAAATACATGAGACCTGACCGTTGATGAATGTATAGTGTGGTGGCTTTATAACTGGCTGCATATTGGGGCTTTTTCAAAGAATGCATGTCTGGGTCCTATCACAAGAAATTCTGACAATTGATTTGGGGTTCTGTCCTATAACACAAACAGTTTCTGGGGTGATTCTGAAGTTCTATGACTGGTTTAGAGCCTGGCGCGTTAGAGGACAAGTAACTGGGAAAACAAGTTCTACCCCTGGCTCTGCAAATAAAGTCATCCCTCCTTTTTAGAAGATACATAGCTAAAGAGTAAACAAGGCAAATTTTAACAGGTTTTGGCAACATCGGTTTTACATATATTTTAGATTAAAAGGTAAAAGTAAATACTAGTACTTTGCTGATAGGTTGTATCTAGACTTGTATTTTATATACATTACTTGGAATTTTAACAATGTGTAGGTTATTCACTATGAAATTCTTAACTTTAGGACTGAAAAGCATGTCACATAGGCCAAATTCATTCAGCAAAACTTCTGTTGGCACAGTGAATAATATTAACTACCAGGTTGTATGCTTAAATGCTTTATTTTGTTGAATTCTATTCCTATTATGTAGATCCAGAAATTGGCTTAGAGTTTTAACTTGCCCATTGTCCTAGAGCTTGAAACCATAGCTGAGATTTAAACAGGTATACAAGATGAGAATCCATCTTTTGATATCCCATTAAAGTATTGAAAAGTTT