Transcript asmbl_70440

Sequence
Transcript Sequence for observation asmbl_70440 of TGE0007199:
CCGCCGCCGCCGCCGGCTTGGTTTGTGAGGAAGGGCCTAGGCCCAGGCCTGCTGTGCTGGGCTCGCTGAGCGCCGGAGCTCGCGTCCTGCTGTCACCTCTACCCCAGCTTCGCCCACAGCCCGTCCCAAACGGGCTGGGCGCAGGGGAGACCTGCCGGAGCCATGGAGGACGAGGTGGTCCGCATTGCCAAGAAGATGGACAAGATGGTGCAGAAGAAGAACGCGGCTGGAGCACTGGATTTGCTGAAGGAGCTTAAGAATATTCCCATGACCCTGGAATTATTACAGTCTACGAGAATCGGAATGTCAGTGAATGCCATTCGCAAGCAGAGTACAGATGAAGAAGTTACATCTTTAGCAAAGTCTCTCATCAAATCCTGGAAAAAGTTATTAGATGGACCATCAACTGATAAAGATCCTGAAGAAAAGAAAAAAGATACTGCAATTACATCACAGAATAGCCCAGAGGCAAGAGAAGAAAGTAGCTCCAGTGGCAATGTAAGCAGCAGAAAGGATGAGACAAATGCTCGAGATACTTACGTGTCATCTTTCCCTCGGGCACCAAGCACATCTGATTCTGTACGGTTAAAGTGTAGGGAGATGCTTGCTGCAGCTCTTCGAACAGGAGATGACTATATCGCTATCGGAGCTGATGAGGAAGAATTAGGATCTCAAATTGAGGAAGCTATATATCAAGAAATAAGGAATACAGACATGAAATACAAAAACAGAGTACGAAGTAGAATATCAAATCTTAAGGATGCAAAGAATCCAAATTTAAGGAAGAATGTACTGTGTGGGAATATTTCTCCTGACTTATTTGCTAGAATGACTGCAGAGGAAATGGCTAGTGATGAGCTCAAAGAGATGCGGAAAAACTTGACCAAAGAAGCCATCAGAGAGCATCAGATGGCCAAGACAGGTGGAACCCAGACTGACTTATTCACATGTGGCAAATGTAAAAAGAAGAATTGTACTTATACACAGGTACAGACCCGTAGTGCTGATGAACCGATGACAACATTCGTTGTCTGTAATGAATGTGGAAATCGATGGAAGTTCTGTTGAATTGGAAGAATTGGCAAAATGTCTGGACCATTAAGAAAATGGATTTTGTAATTAGCTTTAAAACTAGGCCAAGGAACTAGGTTTTCTGCAAGTCAGGTTTTTAAAGTGACATACACCCCTTGGTTAGTCTTTGTTTTTGACATAGCATCCTTCCTTAAATGCCTTCTGTAGTTTCAGATCAGTAGGGAGACTACATAATAATTGTATGGTATCCGTTTCAAACATTTCTTTTTCATTTTTATAGGTAATCGATATTAAACTTTTATCAATTAAACTTTTGGCAATTTATTTTTACCTTTTTTCCTTCTTAAAGGGAAATGTACCTTAACTTTTTTACAGTCTGAAACATACACAGTAGAAATGTTATTTTCACTTAACACATAAATGAAAATTACATTTTTTTTCCATATTGGCATGTACCTGCAAATGTTAACAGAGAAGAGAGGTAATATAATTTTAAGTTTATCAACTGTGGTGTGTATTCAAATAATACTTGAGCAGCTCAACTAAATTGTACATAATATTTGAAGTAGCATATGAAATTGGTTTTAATTATTATATTCACAAGTCTGGGATAATTAGATATTTTTTTTTATTTGTAACTAACCGTGACCATCATTTCTTGTAATTTCTTGTACATGTTATTACTTGTTCCTAATAGATTTTACTTTTGGAAACATGACTTGACTTTGTTGAAATCAGTTTGGGTTTGTTGTCTGTTTACCTGTTTGACTTCATAGTGGATTTTAGTTTTGCAGAACACTGTTTAGGTTAGTAGGCTTTTCATAAATCCCAGCACAGGCAGAGAATGAAAGCTCCTGGCAATTTTCTTCCCCTCATAAGAAGACATACTGGGAAGAAAACATTAGCATTTTAGTATAGTGTAATTATAAGTAGTTCATGACTTGATTTTGATTTGGAAATCTATACTGACCAAGGATCAAGTTTAAGGATTATATAAATTCTTTCCATATGGAGGTCGATAGAAAATATTTTTGTCCTAAGTCTAATTGGCTGACTTTTTCTGTTACACAGTGAATGAGGTTGTTGAACAAACTGAATATATGGCCTATAATGCAATTTGTTTTATAGTACAGATCTTACAATTAAGTTTTACTTTTTGTTTAAGTGTGTATCATTTGTTTTGTTAGGATAAGAAAAAAATGACTTTCACTTAGGTTCCTGAGGGCACACTTGCTCTAGTACATCTTAAAGGCCACTGTTACAAAGTTCACATTTTATCATGTTACATCTGTATTCTGTCAGATACCTACAGAAGGACCTAAGTACATGCTTTGCAGTCCCCTTTGTTCCCATATTCTCATTTGTTATTGGAAATAACTTGACGTAATACAGAGACGACATTTAAAGGTCCATGTTAAGACCCCACCTATAAGAATTGGCCCACTGGTATCATTCCACTTCTGCTTTGTCAGTTCACAGATTAATATTTTGTTTTATCATTTGAAAAATAAAGTACATTTTTGAAAGAATGAATTTTAAGAAGAATAAAATTAAAATTGTCCCACTTTTAAATTTAGTGATCCATTTTAAAATTTGTAATTCAATAAAGTTTCTTG