Transcript asmbl_70006

Sequence
Transcript Sequence for observation asmbl_70006 of TGE0007193:
AGCTCAAGAGATGGCTGCCCAGTGTGTGACAAAGGTGGAGCTGAATATTTCCTGCGACAATCTTCTGGATAAAGACATAGGGTCCAAGTCGGACCCGTTATGCGTGTTATTTTTGAATACGAGCGGCCAGCAGTGGTATGAGGTTGAGCGCACAGAAAAGGTCAAGAATTGCTTGAATCCCACATTTTCCAAGACTTTCATTATTGATTACTACTTCGAAGTGGTTCAGAAATTGAAATTTGGGATTTATGACATCGACAACAAGACTATAGAGCTGGGCGATGATGACTTCTTAGGAGAATGTGAATGCACCCTTGGACAAATTGTTTCCAGTAAGAAGCTGACCCGACCCCTGGTGCTTAAGAATGGCAGACCTGCGGGGAAAGGCAGCATCACGATTTCGGCTGAAGAGATAAAGGATAACAGAGTCGTCTTGTTTGAAATGGAAGCCAGGAAACTGGATAATAAGGATCTCTTTGGGAAGTCAGATCCGTACCTGGAATTCCACAAGCAGACATCTGATGGCAACTGGCTCATGGTTCACCGGACAGAGGTTATTAAAAACAACTTGAATCCTGTTTGGAGGCCTTTTAAAATCTCCCTTAACTCCCTGTGCTATGGAGATATGGATAAGATTATCAAGGTAGAGTGCTATGACTACGATAACGATGGGTCACATGATCTCATTGGAACATTCCAAACCACCATGACGAAACTGAAAGAGGCCTCCAGGAGCTCGCCTGTTGAATTTGAATGCATAAATGAAAAGAAGAGACAGAAGAAGAAAAGCTACAAGAATTCCGGTGTCATCAGTGTGAAGCAGTGTGAGATTACAGTGGAATGCACATTCCTTGACTATATCATGGGAGGCTGTCAGCTGAATTTTACTGTGGGGGTGGACTTCACTGGCTCCAACGGTGACCCACGGTCTCCTGACTCCCTTCATTACATCAGCCCCAACGGCGTGAATGAGTACTTGACCGCCATCTGGTCTGTGGGGCTGGTCATTCAGGATTACGATGCTGATAAGATGTTTCCAGCCTTTGGGTTCGGAGCTCAGATTCCTCCTCAGTGGCAGGTGTCGCACGAATTCCCCATGAGCTTTAACCCGTCCAACCCCTACTGTAATGGAATCCAAGGCATTGTGGAGGCATATCGGGCCTGTCTTCCTCAGATAAAACTCTATGGACCAACAAATTTTTCTCCCATCATCAATCACGTGGCCAGGTTTGCTGCCGCAGCCACACAGCAGCAGACAGCTTCTCAATACTTCGTGCTGCTCATCATCACCGACGGTGTGATCACGGACCTGGACGAGACCAGACAGGCGATCGTCAGCGCCGCCAAGCTGCCCATGTCCATCATCATCGTTGGCGTCGGCGGCGCTGACTTCAGCGCCATGGAGTTTCTGGACGGTGACGGTGGGGGCCTGCGCTCCCCGTCAGGGGAGACTGCCATCAGGGACATCGTGCAGTTCGTGCCTTTCAGGCAGTTCCAGAATGCTCCCCGAGAAGCGCTGGCTCAGTGCGTCCTGGCGGAGGTCCCCCAGCAGGTGGTGGGCTACTTCAATACCTGCAAGCTCCTGCCCCCCAAGAACCGCACCGCCCAGTGAAAACGCTCCTGCGCCGCACTGCGGGCTGCCCGTTTCCCACGCTCCCCAGCATCCGTGACGGAAACCGAGTCCCCGTGGACTGCGTCTCCTTAAAGCATTCTTTTATACTTTTCTTGGAAGAAAGTGCTAACTTAACCTTTGTCCAATCAATTCAGTGATTGCTAGTGATTAGAGACTCGCACGAGGAAAGCCGCCTTTGCCATGGTGATTGTTTGCTCTCACAGGATGAAGATGCTGGTTGGAACATTCGTCAGTAGAGAGGATGAAGACTTGTTGGGGGTGGGGGAATTTCAGGCCGCTGTGCTTCGTCGGCTCGAGGCCACATGTGCTACAAGTCAGTGTCCGTCCCCGGTGACGGGCGCTTCTCAAAGCAGACGTGCTGAACCTGTCCCTGCAGTTGCTGAGTGCCTGACCCTTGCCCAAGTCTCGCTGCGGCTTAGCCACAGCACAGCTCGCCCCAGCAGCACCCCAAGACTCTCCGAAGAGCGCAGACGAGGACAGGCACCCTTGCACTTCTCAAAAGGAAGAGGAGCCTCAGGAACGTGCGCGGCTGTTCCCGTGTGCCTTTCCAGGACCCGTGTCTGCACGGAGGGCAGGCCGACCGGGCTCAGCGTCAGTAGCGTTTTTTAATTGGAGTTTGTCAGAATGGTTACGACTGCCTAGTCCAGGAAAGCTACGAGGACCAGACGTGTAGAGAAAACTGAGAATCCCTTCCCTTTTAGCCAATGAAGACTTTACTTACTAAGAAAGGACAATTTTTATCCTTGCTGAGGTCCTATACATTGATTAGTACATTTCTTCACATTCGTGTAGACATTTTTTCCTGTTTTCTTTAGTTACTCTTTTAGTCTGGTTTTTAAACTCATGATAGTGGTTGTCTATTAATCAAAATCATATTTTGCATTTTAATAATGTGCTATTTCCTAAGCCCAGAATGTACTGTATTAAGCCTAAAACCTGTTGCAACTTAAAAAAAATAGCCAACATGCTCTAAGAGCAGAATTCCCCCTTTCAGAATACATTACTCAGCAAACGCTGTCAGAACAGTCAGTAATGTTTTATTGAGGACCTGTGTGCCAGGTACCACGCATACCCACATGTTGGCCAATTATCTTGGATAATTTGACATGAAAATTTGCATGTTTGTCATGTACCCTCAAGGGGACACGCCCAGTGCCATGCCAGCATGCCTTTCGCTCTTTCTGAAACTGCGCCACGGCTCTGGTCTCTTGTTCTCTGAGATGTCTGAAGGACGCGTGAGCCTCGGCCAGGCTCCGTCTGAGAGGGGAGCTGCCTGCTGTCGTGGTCACCCAGCCAGGCGGGCAGTCACCGCCTTCCCGCTCAGTCCGCTGGTCCCTGGCTGCGCGCTGCTGACCTGAAGGCGCCTGACTGGCCGTCTGTACTCCA