Transcript asmbl_6916

Sequence
Transcript Sequence for observation asmbl_6916 of TGE0007136:
CGCGGTGTCCGGTCCCAGCCTTCTCTGGGAGCGGGCGGTGGGCAACGCCGGGGTGACCCGCGCCCCTCGTTCTTGAGCCCGCGCGCTCTGAGAGGGTGCTCGGACAGATTGAAGCCATGGCTATTCTTTTTGCCGTCGTTGCCAGGGGAACCACCATCCTTGCCAAACACGCTTGGTGTGGAGGAAACTTCCTGGAGGTGACAGAGCAGATTCTGGCTAAGATACCTTCTGAAAATAACAAACTAACGTACTCACACAGCAACTATTTGTTTCATTACATCTGCCAAGACAGGATCGTGTACCTTTGTATCACTGATGATGATTTTGAACGTTCCAGAGCCTTTAATTTTCTGAATGAGATCAAGAAGAGATTCCAGACCACGTATGGTTCAAGGGCACAGACAGCACTCCCATATGCCATGAACAGTGAGTTCTCAAGTGTCTTGGCCGCACAGCTGAAGCATCATTCTGAGAATAAGGGCCTAGACAAAGTGATGGAGACTCAAGCCCAAGTGGATGAACTGAAAGGAATCATGGTCAGAAACATAGATCTGGTAGCTCAACGAGGAGAAAGATTGGAATTATTGATAGATAAAACAGAAAATCTCGTGGATTCGTCTGTCACCTTCAAAACAACCAGCAGAAACCTTGCCCGAGCCATGTGCATGAAGAATCTCAAGCTCACCATCATCATCATCGTCGTATCAATCGTGTTCATCTACATCATCGTGTCACCTCTGTGTGGTGGATTTACATGGCCCCGCTGTGTGTAAAAATAGAAAAGACAAAGTTATTCACCGGACGACACGAGAGAACAAGGAGTTAAAAGGCCGAATGATCTAAACCTTTCACTACTGACAGATGGCGTCTGCCAGTCTCTTCAGCCCTCTCTTTCTCTTTCTGTTTTTAATCCTGTTCTATGCATCCAGATTTATCTTTGTCCTCTCAGTCAGTTTATTCCAGTGTACTTCAAAATGAACCATTTATTGCAGCAGTAGCCTTAAAAAGGCTTTTGTCCGTTCCTTTGGTTTGTTCACTAGTATTATAGACTCAGAGAAACGTTTTCGTCGGTGATTGCACAAAGCCATCGCCAAGGTGGAAAACACCAGTCTTGTAAACTGCCTGCTAAAACTGTAGCTGAACATTGTACGTGCACAGAAAAGTATTCGAGAGACACGTATTGCTACCATCTCATGTTTATGTCTTTTGGTATTGAGGAGTTTTAGATGCTCGAAAACAATACGAATGGAGAATTACTGTTATTTGGGGAATTGTAATTCAATTGTTGGTGCTGCCTGCTTCTAGCAGCCCAAGCAGATAAAGTATTAGACATTCTGTCTTGGTCAGAGGGAGAATATTTTTAGAAGCACGTGGAATTATGTTCGACTTCCTAGTACTCACTTTCAGGAAGAAAGATTTGACCATTTGCAAACCTCACAGAGCTCAGTAGCTTCTGTTTCCCCGTTGCAGTTGATTTGAGAAGATAATGGTTTAAATATGGCCGAAGGTTATGGTTTTCCACATATTTCTTTGGTCCTCAGTTGATTTTTAGAGCCATTCTATAGTTAATAGAATAGACAGTGG