Transcript asmbl_6872

Sequence
Transcript Sequence for observation asmbl_6872 of TGE0007115:
GGGTGTTCTGCGAAGGGGTAGATCCGGTTCAGTGAGAGAATGATAAACGACTGAGAGAAGGATCAAGGAAACAACTGAGGAGAATTTAGGGGCAGGTTATGCGACGTGGAAATGGGGGCATAGGTTTCTGGGGAGGGCACACACGGAGTGGCGTCTTGCATCTCTCGGTAGATTCCAGAATCCTCCGCTATTCAGGACCGTGCAGGAAGACCATGCCGAGACCCAAGAAGAGGATGGCTGGGGCTGCTGAGCCAGACAAGAAGGGACCAGCAGGAAAACGTCCCAAGATTAAGAACCTAGGTGAGACATCAACTAAAGTGGAGAACTCCAGCCCTCAGAAGACTTCAACCTCTAAAAATTGCACGAAAAATCTAAGCAGCTATTGGCTGATGAAGTCAGAGCCAGAAAGCCGTCTAGAGAAAGGTGTAGATGTGAAGTTCAGCATTGAGGATCTCAAAGCACAGCCCAAGCAGACAGCATGCTGGGATGGTGTCCGCAACTATCAGGCTCGGAACTTCCTTAGAGCCATGAAGCTGGAGGAAGAAGCTTTCTTCTACCATAGCAACTGCAAAGAGCCAGGCATTGCCGGACTTATTAAGATTGTGAAGGAGGCTTACCCAGACCACACACAGTTTGAGAAAAGCAATCCCTATTATGATCCCTCCAGCAAAGAAGACAACCCCAAATGGGCCATGGTGGATGTACAGTTTGTTCGGATGATGAAGCGTTTCATTTCCTTGGCGGAGCTCAAAACCCATCACCAAGCTCACAAAGCCACTGGTGGCCCCTTAAAAAATATGGCACTCTTCACTCGCCAGAGACTCTCAATTCAGCCCCTGACCCAAGAAGAATTTGATTTTATTTTGAGCCTGGAGGAAAAGGAACCAAGTTAACTGATACGCTGGAATGGGCAAGACATTATTCCAAAGGAGTGAAGCTTTTATAAGACAAAAGGTGTGAGGAGGCTTGCTTGTTATGTTCATTGGGGTTTGTGTACATAGGTGGGTTTTGTGTACTTTCTCAATAAAATGCTAATATCAA