Transcript asmbl_68381

Sequence
Transcript Sequence for observation asmbl_68381 of TGE0007071:
CGGCCCTCCCGCCGCATGCCGGGAATTGTAGTCTAATGAGGCCTTCCTGCCTCGGACGAAAGGAGATCAAGAACTACTCGACCCAGGTGGCTGAGCGCGGAGCGGTGCCACTTTTAGGAATACTCCACGAAAAACCTGCAGGGTGAGCCGGCTTCCAGGAACAGGGCACATTACTCCTCCCTCAGAATGAATGGAGATCAGAAATCGGATGCTTTCATGCAAGAAAAGCAGAATTTCCTCCAGTGTTTCCCAGTGATCATCAAGGTGCTGACCGATGACTTGGAACACCCAGAGATAAAGGAAGTTCTTGCCCGGCTCAAGCAGGTCCTGGAGTACAATGTCATCGGTGGCAAGCATCAGCGGGGTCTGCTGGTGCTGATCGCGTTCCGGGCGCTGGTCGAGCCGAGAAAGCAGGACGCCGCGAGTGTGCATCGGGCCCTGGTGGTGGGCTGGTGCGTGGAGATGCTCCAGACCTTCTTTCTGGTGCTAGACGACATCATGGACTCATCCATCACCCGACGGGGGCAGCTCTGCTGGTATCGGAAGCCAGGCGTTGGCTTGGATGCCATCAACGACGGTCTTCTCATCGAAACGTGTATCTACCGCCTGCTAAAGCACTACTGCCGGGAGCAGCCCTATTACCTGAACCTGATGGAGCTCTTCCTGCAGAGTTCCTACGTGACAGAGATTGGACAGAGCCTGGACCTCATCGCAGGCCTCCAGGACAAGGTGGATCTCTCAGGATTCACTGAAAAGAGGTACAAGACTATCGTCAAGTACAAGACAGCTTTCTACACTGCCTACCTTCCCGTGGCTGCAGGCATGTACATGGCGGGCATCGATGGGGAGAGGGAGCATGCCACCGCCAAGAAGATCCTGTTCGAGATAGGGGAGTTCTTCCAGATCCAGGACGATTACCTTGATGCCTTTGGGGACCCCAGTGTGACAGGCAAGATTGGCACTGACATCCAGGACAACAAATGCAGCTGGCTGGTGGTTCAGTGTCTGCAGAGGGCCTCCCCGGAGCAGCGCCAGGTCCTGCAGGAGAACTATGGGCAGAAGGAAGCCGAGAAGGTGGCCCGGGTGAAGGCGCTCTACGAGGAGCTGGACCTGCCGGGCGTGTTCTCGCGGTACGAGGAGGACAGCTACCGCCGCATCACGGGGCTCATCGGGGACCTCGCCCCGCCCCTGCCCCCTTCCATCTTCCTGGAGCTGGCACACCACTTCTACAAGCGCAAGAAATGAACTGGAGTGTGGCGCGGGGGGGCCCAATAAACGACACAAGTCCTCGCCTCTGGCTGATGGTTCTTGGGGAGTGCGACGTGTAG