Transcript asmbl_67099

Sequence
Transcript Sequence for observation asmbl_67099 of TGE0007022:
CTGCCACCTCTTACCAGCGCCGTTGCTGCGGGGGATTGTGGGATCCTTCGCGTCCTGTTCGCTAGGAGAGAGAGTTGTCTGCTGGTTCTCAGCTTGAAGAAGATTCTACAGTCCTTATTGATCCTTTTTCTTGGCGTTACCATTTTTTTGAAGCAAAGTTGACCTAGTTTTGTAGTTTGAGCTTTCTTTTTGGCCATCTTTTAAGAAAATTTTTTTGGTAATCTATAAATTAGCCAAGAGATAGTTCTACAATGTCCAAGTCATTCCAGCAGTCATCTCTCGGTAGGGACTCGCAGGGTCATGGGCGTGACCTGTCTTATAGGCCTTCTTGCTGCTGCTACCCAGTCTTTAAGTATGCCAGCATCTCTTGGAAGGATGAACCAGGGTACTGCACGCCTTGCTAGTTTAATGAATCTTGGAATGAGTTCTTCATTGAATCAACAAGGAGCTCATAGTGCACTGTCTTCTGCTAGTACTTCTTCCCATAATTTGCAGTCTATATTTAACATTGGAAGTAGAGGTCCACTCCCTTTGTCTTCTCAACACCGTGGAGATGCAGACCAGGCCAGTAACATTTTGGCCAGCTTTGGTCTGTCTGCTAGAGACTTAGATGAACTGAGTCGTTATCCAGAGGACAAGATTACTCCTGAGAATTTGCCCCAAATCCTTCTACAGCTTAAAAGGAGGAGAACTGAAGAAGGCCCTACATTGAGTTATGGTAGAGATGGCAGATCTGCTACACGGGAGCCACCATACAGAGTACCTAGGGATGATTGGGAAGAAAAAAGGCACTTTAGAAGAGATAGTTTTGATGATCGTGGTCCTAGTCTCAACCCAGTGCTTGATTATGACCATGGAAGTCGTTCTCAAGAATCTGGTTATTATGACAGAATGGATTATGAAGATGACAGATTAAGAGATGGAGAAAGGTGTAGGGATGATTCTTTTTTTGGTGAGACCTCGCATAACTATCATAAATTTGACAGTGAGTATGAGAGAATGGGACGTGGTCCTGGCCCCTTACAAGAGAGATCTCTCTTTGAGAAAAAGAGGGGCGCTCCTCCAAGTAGCAATATTGAAGACTTCCATGGACTCTTACCGAAGGGTTATCCCCATCTGTGCTCTATATGTGATTTGCCAGTTCATTCTAATAAGGAGTGGAGTCAACATATCAATGGAGCAAGTCACAGTCGTCGATGCCAGCTTCTTCTTGAAATCTACCCAGAATGGAATCCTGACAATGATACAGGACACACAATGGGTGATCCGTTCATGTTGCAGCAGTCTACAAACCCAGCACCAGGAATTCTGGGACCTCCACCTCCCTCGTTTCATCTTGGGGGACCAGCAGTTGGACCAAGAGGAAATCTAGGTGCTGGAAATGGGAACCTGCAAGGACCAAGACACATGCAGAAAGGCAGAGTGGAAACTAGCCGAGTTGTTCACATCATGGATTTTCAGCGAGGGAAAAACTTAAGATATCAATTATTACAGCTGGTGGAACCATTTGGAGTAATTTCCAATCATCTGATTTTAAATAAAATCAATGAGGCATTTATTGAAATGGCAACCACAGAGGATGCTCAGGCTGCAGTGGATTACTATACAACCACACCAGCATTAGTATTTGGCAAGCCAGTGAGAGTTCATTTATCCCAGAAGTATAAAAGAATAAAGAAACCTGAAGGGAAGCCAGATCAGAAGTTTGATCAAAAGCAAGAGCTTGGACGAGTGATACATCTCAGCAATTTACCTCATTCTGGATATTCTGACAGTGCTGTCCTTAAGCTTGCTGAGCCTTATGGGAAAATAAAGAATTATATACTGATGAGGATGAAAAGTCAGGCATTTATAGAGATGGAGACCAGAGAAGATGCAATGGCAATGGTTGACCACTGTTTGAAAAAGGCCCTTTGGTTCCAGGGGAGATGTGTGAAAGTTGACCTGTCTGAAAAATATAAAAAATTGGTACTAAGGATTCCCAACAGAGGCATTGACTTACTGAAAAAAGATAAATCCCGAAAAAGATCTTATTCTCCAGATGGCAAAGAATCTCCTAGTGATAAGAAATCCAAAACTGATGGTTCTCAGAAGACTGAAAGTACAAATGAAGGTAAAGAACAAGAAGAGAAGTCAGGTGAAGATGGTGAAAAAGATACAAAGGATGACCAGACAGAACAAGAACCTAGCATGCTTCTTGAATCCGAAGATGAATTACTCGTAGATGAAGAAGAAGCAGCAGCACTGCTAGAAAGTGGCAGTTCAGTGGGAGATGAAACAGATCTTGCTAATTTAGGTGATGTGACTTCTGATGGGAAAAAGGAACCTTCAGACAAAGCTGTGAAAAAAGATGGAAGTGCTTCAGCAGCTGCAAAGAAAAAGCTTAAAAAGGTGGACAAGATCGAGGAACTTGATCAAGAAAATGAAGCAGCGTTGGAAAATGGAATTAAAAATGAGGAAAATACAGAACCAGGCGCTGAATCTGCTGAGAATGCTGATGATCCCAACAAAGATACAAGTGAAAATGCAGATGGCCAAAGTGACGAAAACAAGGAGGACTATACAATCCCAGATGAGTATAGAATTGGACCGTATCAGCCCAATGTTCCTGTTGGTATAGACTATGTGATACCTAAAACAGGGTTTTACTGTAAGCTGTGTTCACTCTTTTATACAAATGAAGAAGTTGCAAAGAATACTCATTGCAGCAGCCTTCCTCATTATCAGAAATTAAAGAAATTTCTGAATAAATTGGCAGAAGAACGCAGGCAGAAGAAGGAAGCTTAAGATGTACAAGAATCTTAATGATTTCAAAAGAAAATAATGGTTCTTTGTTTTTAATGTTAACTTTTTTAAAATACAATACTGATAGTTAGAAGAAAACTATTGTACTCTTTTGTTTTAGTGGAAAAATAATAGATGTCTGTTCATGTGTTAAGTGTTATAGCAAAAATGCATATACGGTTAAGTTAATGAAAAATTGTTTTTGTTTTATCGAAATGGTAACAGACAGAAGTACTTGTAGAGACTGACTTCGTAAACTACTTAAGACAACTTGCACCACTAAGAAAAAGATACGTAGAACTATTCAAAGAAATGAAATTTAGTAGTTCTAAGCTTCAAAGAAATGTCAAAACTTTTGATTCCATTCAATAAAGAACAAAACCAATTGTATTTTTATTACTTTCATCTGAAACATTCCACATTTTAATCTGAGCCTTGTAGACTTCTCATTTGGAGTTTGAAGCTTTTTTGGTTACATTTCATTTTCGGAGAACTTCATTAATGTGTGATTAGCAATTAAAATGCAGGTGCAGTTTTCTTTTAATGTTATGCTGTTGCTTAGGTAATAAGAAATATTAAGTAATTGGCTTTAGATTTTGTAATTTTTTCCCCTAAGTTCCTGCTAGATTTCGTATTCTAGTAGTCAATGTATTTTCAGTGAAATGTAAAAATACTCCCATTCTCTTTGACCAGTATTAATTTCTTGAAACCTTATTGCTTGTCACTTGAATCCTATAGCTGTCATACATCTGGTATAAGCAACATTTGATTTTTGAAGTGTGTAGACCATCTCTTCATATTTTCAAGATGTAATTTTACATTTCTGCATTTTAAAAAGTTTGGCCATAAGCTAGACGCACGCTTCTAATTCATATACCTGCACATGTGATCTTTGTGAACAGAAATTTGCATGTATAATCTGTGTTTACTTGTAACTTTCTGGTTATATACTGCTTATATCTGTGGATTCAAGTTTCTGAAGTGAATACCAATAAAAAAAAAACCTAGGCCATGTTCATTGGTTATACATGTTTGGAATGTTAACCAATATATTGTCAGTTGTGGTTTTTATTCACTGTTACACTTTTGCATGCTTTAACAAATTTTTACATTTTCAATCTAGAGTGTTCTGAAGATTGCTACTAAAGATATGAATTTTAAAGTTTTTGGTGCTGGTGGATTTCTTGTTCCTGTTACATAACAAAAGTGGGACTATTGGTTTTTTTAAACCTCAGGAGTTATAAATGCTAAAGACAAATAGCAAATGCTAATGTTTAGACATGTCGAAGTAGTTAACAGTAAAATTGAAAGTAACATGGTGGAATAGTAAGAATTCTAGCAGCCTTTCAAAATGTTGGGGGTCTTAGTATAAGGGAGTATCAGTTCTCAAATTTTTTTTAATTTAATAAGAACTTACAGGAATTCTTTTTGAAACTCTTAGTTCCAAGTGTATTAAAGGATATTTCAAATATTTCAATAAAATTTTATGGTATACCTCTGCAGGTCATGATATTTTTTAATGTAACATGAACAAAAAAATTTTGCCAGTTTCTTCAGTTTAATTTTGG