Transcript asmbl_66866

Sequence
Transcript Sequence for observation asmbl_66866 of TGE0002143:
GTGATGTCACAGGCCCCATGTGAGCGGATTGCAACACATGCAGCTGCCTGGAGAGAGGGAACCGGTGTCCTACGTCAGAGCCGCCGCCGCGGAGCCGCCGCCGGGGAGGAGCAGCCACTGCCGCCCAGGACTGGGCCCTTAGGGAGGAGGAGGCGAGAAGATGGCGGACGACCCCAGTGCTGCCGATAGGAACGTGGAGATCTGGAAGATCAAGAAGCTCATTAAGAGCTTGGAGGCGGCCCGCGGCAATGGCACAAGCATGATATCATTGATCATTCCTCCCAAAGACCAGATTTCACGAGTGGCAAAAATGTTAGCAGATGAGTTTGGAACTGCATCTAACATTAAGTCACGAGTAAACCGCCTTTCAGTCCTGGGAGCCATTACATCTGTACAACAAAGACTCAAACTTTATAACAAAGTACCTCCAAACGGCCTGGTTGTTTACTGTGGTACAATTGTAACGGAAGAAGGAAAGGAAAAGAAAGTCAACATTGACTTTGAACCTTTCAAACCAATTAATACGTCATTGTATTTGTGTGACAACAAATTCCATACAGAGGCTCTTACAGCACTACTTTCGGATGATAGCAAGTTTGGCTTCATTGTAATAGATGGTAGTGGTGCACTTTTTGGCACACTCCAAGGAAACACAAGAGAAGTCCTGCACAAATTCACTGTGGATCTCCCAAAGAAACATGGTAGGGGAGGTCAGTCAGCCTTGCGTTTTGCCCGTTTAAGAATGGAAAAGCGACATAACTATGTTCGGAAAGTAGCTGAGACTGCTGTGCAGCTGTTTATTTCTGGGGACAAAGTGAATGTGGCTGGTCTCGTTTTAGCTGGATCAGCTGACTTTAAAACTGAACTAAGTCAATCTGATATGTTTGATCAGAGGTTGCAATCAAAAGTTTTAAAATTAGTTGATATATCTTATGGTGGTGAAAATGGATTCAACCAGGCTATTGAGTTATCTACTGAAGTCCTCTCCAACGTGAAATTCATTCAAGAGAAGAAATTAATAGGACGATACTTTGATGAAATCAGCCAGGACACGGGCAAGTACTGTTTTGGAGTTGAAGATACACTAAAGGCTTTAGAAATGGGAGCTGTAGAGATTCTAATAGTCTATGAAAATCTGGATATAATGAGATATGTTCTTCATTGCCAAGGCACAGAAGAGGAGAAAATTCTCTATCTAACTCCAGAACAAGAGAAGGATAAATCTCATTTCACAGACAAAGAGACAGGACAAGAACATGAACTAATTGAGAGCATGCCCCTGCTGGAATGGTTTGCTAACAACTATAAAAAATTTGGAGCTACATTGGAAATTGTCACAGATAAGTCACAAGAAGGATCCCAGTTTGTGAAAGGATTTGGTGGAATTGGAGGTATCTTGCGGTACCGAGTAGATTTCCAGGGAATGGAATACCAAGGAGGAGACGATGAATTTTTTGACCTTGATGACTACTAGGTAGTCGACATGGGTCCGGCAAAATGTGCCTCACCCTCCAGCATCCAACCCAAGGAGCATACCCGTGGTGGAATCCAAACAGATCCCTGCCTTACAATTGGAACATTTCCAGAACTTAATCCATGAGCATTGGATATTGAAAAGAAAACCGAAACAAAACCAGACCCAACCCTACACTTTGGTTTGTCATGGTGTCAGCGCAGCAGCCTACAACTAAGTTCCTAAATGCCACTTTGGACTAATTTAAACAAGAATCCCAGTTTTTACTTTTACTCGATGGTGAAATTGGTTGCTCTTGTATTTTATGAAAAAAAAATGATTTTTTTAACCTTCATACATAGAAGCAAAAATACTTTAACTGCTGTAAACCTTCAAAAGTTAATAGAAATGAGATCATACTGGTTTGTTTCTTATTTTGATTGGAGAAAAATTAAATTGCTGCATTTCGCAGTGACCCATTTACATGGCATTCTCAGCTTAGACTGCATAAGAAGAAATATACGTGGTGAAATGTTGGAACCATTTCTCTCTTGGTCTCTTGTTTAATGTTGAAAGGGTGAGCTAATAGGCAATTTCAACTTCACTCCCTCACACTACCCGTGCCCCTACAGACTGTCAGTTTCAAGGATGCAAATTGCATTGCAGCGTCAAACTGACAACATGAAGCATTTGGGCCAGTGCACCGTTTCCTTCCACGTGTTTTGCAGGCGCATTTGTGCCCAGGGTTTGGGAGCCCTTAGCATCAATTGCTTTGACAAGGGTTCTCATAATCTTAGCCTACTAGAAACCAGTTTGGGATGGATATGGGGCTTCTGTGCTATTGCTGGGATTGGGAGAAATAAAACATGCAATATAAATGGAAGCAAAGAAATTTAAAGAATATTTTATTTTGCTTGGGTCTATCCTTGGTCAAAGGGAGGTGGTCGTGTTTTCCTTGTGTTGGATGGCATGAGATTATGTGAATGTTTTGATTTTTTAAAAAAAATGAACTGCAAGGTTTTTCACAGGAACGACAGACAAGACACGTATGACTGTGCATGTAATTATAAGCCCCTGACCTCCTGGTGGGGTTGGAGCATCTGTTTCGAATATGGGACTTGTAAACACCTCTCATAGGAGAAA