Transcript asmbl_66240

Sequence
Transcript Sequence for observation asmbl_66240 of TGE0006944:
GCCGCGTAGTCTTTCCTGCCCCTTGTCCGCCTCTTCTTCCTGCTCGCGGCCCGCCCGCCGGCTCGCACCCAGCCGCAGCGGCGTGGACGGAGGATACGACTGGGACGGCGCCGGGAGCCGAGGTGCTGAGGGACGGTGGCCGACTTAGGAGAGATGCTGGGCGTGGCGGCAGGAATGACCAACAGCAACATGGCCAATGCCCTTGCCAATGCTGCTTGTGAGCGCTGCAGGGGGGGTTTTGCACCCGCCGAGAAGATTGTAAACAGTAATGGCGAGCTGTACCATGAGCAGTGTTTTGTGTGTGCTCAGTGCTTCCAGCAGTTCCCAGAAGGACTCTTCTATGAGTTTGAAGGAAGGAAATACTGTGAACATGATTTTCAGATGCTCTTTGCTCCTTGCTGTCATCAGTGTGGCGAATTCATCATTGGCCGAGTTATCAAAGCCATGAATAACAGCTGGCATCCTGAGTGCTTCCGCTGTGACCTCTGCCAGGAAGTGTTGGCAGATATCGGGTTTGTCAAGAACGCTGGGAGACATCTGTGTCGCCCCTGTCATAATCGTGAGAAAGCCAGGGGCCTTGGAAAATACATCTGCCAGAAATGCCACGCCATCATTGATGAGCAGCCTCTAATATTCAAGAACGACCCTTACCATCCAGACCATTTCAACTGTGCCAACTGCGGGAAGGAGCTGACTGCTGATGCTCGGGAGCTGAAAGGAGAACTGTACTGCTTGCCGTGCCATGATAAAATGGGGGTCCCCATCTGTGGTGCCTGTCGACGGCCCATTGAAGGGCGTGTGGTAAATGCCATGGGCAAGCAGTGGCACGTGGAGCATTTTGTTTGTGCCAAGTGTGAAAAACCATTTCTTGGACATCGCCATTATGAAAGGAAGGGCCTGGCATATTGTGAAACCCACTATAACCAGCTATTCGGTGATGTTTGTTTCCACTGCAACCGTGTTATAGAAGGTGATGTGGTTTCTGCTCTTAATAAGGCCTGGTGCGTGAACTGTTTTGCCTGTTCTACCTGCAACACTAAGTTAACACTCAAGAATAAATTTGTGGAGTTTGACATGAAACCTGTCTGTAAGAAGTGTTATGAGAAATTTCCACTGGAGCTGAAGAAAAGACTTAAGAAACTAGCTGAGACCTTAGGAAGGAAATAATTTCCTTTATTATTTTCTTCTTTGCAAAGATCAGAGATTACCAACATTATTGATGTGATCTACCCTTATTTAAACCTATTTCTCAAAATAGTTGAGAGTGAAGAAAACCTACATGGTTTTCTTCATCTCTTTTTTTCTCATTAAAAAAGAAAATAAATTTGTGTAATCATATTTAAAACAGATAAAATCAAGATTTGCCTTTGTCAGTAATCATCAATTTGTTTAAGTATAGACTATACTTAATAGCAAAAATCACATAGCTAAATGTTAATTAAGGTCCAAAAATTTACATACAACTTTTTAAAAATGAAAGTAATGAGTCAGCTTTTATAAGACACAGCTAAAAAATATAAACTTTATTTTACTTTGTACTCAAAAGAAAATTAAATCCAACTGCTGTTAGGGACATTGTAGAGAAGAAAACTAACCAAGAAAAACAAATCTTATGGAATCTTAGTATGTTAATCAGACTGGTAGCTACAAAATGAATATACACATTACTAAGACAAGAAACAAGTATATTCAGAACTACTTGATTTTAGAGGTTTTTTGTTGTGAAATTCAATAATTATGCTGTTTTATATTTTGTTCTCCTTGTGAACTTCTTCTTTCATACAATTACTTAACATAGTTACGGCTAGCTTATAGTATGTTTTTTTTAATTTTGTGCAAAAAAAATTTATTCTATGTATTTGACAATACAGCATACTTTACAATATTGGAAAATGGAGTATTTTTTAATGTATTACAGCAATTATGTTTCTAAACATAAGGTCAAAGATGTAGTCTTAGAATAGGACATGAAATTAAATTTTATGTAGCTTGGATGTATCATTTAAAAAAAGTGAATGTATACGTATTGGTCATATTACCTTTATTATAACCATATTAATATCTATGCTTTATACATAACCTTGCCTTGTCTTAGAAAAACACATACCTTAATCAGGAATTCAAGCAGCTTCATATAATACCAACTAAAAATAGGTACACTGGTTGAGATTTATAAACTCAAATTTATTTGCCACAGCTACGATTATTTAAAAAAAATTTTTTTCTCCCTTTTTGGGAAACATTAAAATTAATTTCTGCCATCTTAGTATAAGAGAATGATGTTGATATGTTTCAAGTTTTTCACTTCAAATTTCATAATTAATTGAATTTATTTGCTATAAGTAAGAAGTATAAATGATACTTTTAAATTGGAAAAGGGATGTTTAAGTGTCAATTTTAGGTCAAAAAGTCATGAATTATTCTACTTTATCTTATTCTGAAGTTTCTGGACCATTCTTTCTCGATAAACTTGGATGCAAAGCAAACTTTGTGAACATTATTTAAATGTTGCTGTGTTATTTAAAAGAAAGTTGCCAAGATGGACTTCTAAAGGGAAAATGATTGTTTTCTCCAGAATTTTCTAAAATATTGTTTTGGCATTAAAAATATCTCAGGATGCTACTACTCTGCCATTAAAATATTTGTATGCATGTATTAAAAAGTATGCATGTACTTTATGAGATAAATTCTATTTCGGTTTTCAGATAACTTTATTTTTTAGTGTTCTTTTAGAGTTCAAAGAATTACAGAAGATTGAAATTAATCAATATATATAGTTAAGACTGCATGAGTTCTGAAGTTTCAAACAGTCTTTGCATTTGACAGTAAGAATCGAAATCCCTTCCATGTGCCTTTGTCAGCTAATTTATGACCAGCAGTGAAAACTTTAAAAGTATATAGGGTCTGGATGTTAAATTCTTAAATACCCTACACCAGAAATATGGAGCAGAAAAGTAACTATTTACCTATATCTTAATCACTTTGAAGATGCATGGACAGAACTCAGCTGCTTTGTTTACATATCTTACATAGACAGGTCTCTCCTATTGCCAGAGGTCCCACTGCTATCTTTGCTCACTCTTCTCTTAATATATGAATTAATATTTCTGAAAGTTCAACTTTTTAAGCCTCTAACACTTTAGGGTATTTTATGTAGATACAGTGCTTTCTTCCTCAATAGGGCTATCATTGGAACCCTTATATGTGGGAAAAGAGGAAGCAGTTGAAAAGTTCTAAGTGGAACAGAAGACAAACTTGGTTTAGTTCATACTATTTTTCATGGAGCTTTCTCTAGCTGTGGAAAAACTCAGGCTAGTAAGTATCTATTTAAAGTCTTGCAACGCAATTTTAAATAATTCATAGTTCTTACCATATTTCTAAATGCTCTTTTTCTTACCAAGCCTAATATAATTGGGAAAAAATGTCTGGATACAAATAAAACATTCTTTAGATCATGTTCAAAGCCTTATTAACATTGCACCTGAAATGACAGGCCACTCTGCCTCACTTATTTGCCAAAATGCCATTTCTAAGTTAAGGAAAATTTGAGGTAGGCTTACAGCATTCTTATTGTATTTACTTTTAGATTGTAAGCTCAATGGCAGGGGCACTATACTGATAATTATGTTTTTATATAGCAACCATTGCAGTATACTCTTGGTACTTAATAAAAATTCAGTATCCTACTGTGCATTGTTTAATTCGAATGGCTTTAAAAC