Transcript asmbl_65668

Sequence
Transcript Sequence for observation asmbl_65668 of TGE0013877:
TGCCCCTTCGCCCCATCAGGAGGCCCTGTCCAGCGCCCGCGGGCCGGTCAGCGCCCCTCCTTTGCAGAGCACGAGTTGCTCCGGCGGCTGCTGCCCGAGATGGTGAGGTTCGAGCCCACGTGGGGTGAGCTGGAGCTGTACAAGGACGGCGGCGTGGCCATCATCGACCAGTGGGTCTGCGCCCATGCCAGGTTCTTCATCGGCACGTCCGTCTCCACGTTTTCCTTTCGGATCCACGAGGAGAGGGAGATTCTGGGTTTGGACCCCCGGACGACGTACAACCGCTTCTGTGGGGACCAGGAGGCGGCGTGCGAGCAGCCCACTCACTGGAAGGTCGCGTACTGAGCCGGACCCGTCCCCGCGCGGTTGGCTCGCGGGTGTCCCTCTGATGACGTGTGTCGCCGTGGGGGCCCCCCCACCGCTGGCTGCGCGACCGTCACGTCTCGAGATCTCAGGCCCAGAGGAAGCCACACACGCAGGCGCGGCCCGCGGACCCGTGAGCCCCGCCACGCCCGGCGCTGAACCCGTGCCTGGCATCTCCAGCTGCCTGTGAGGGGACCGCCGGGCACTGCCTGCGCCTCCACCAGGGTCTCAGGCCACGTCTCAGCCCTCAGTGGCCAGTGCGGCCATGGAGGCCGCAGCCTGAGCCCCTTGGCGCAGTCTGGAGGGCGGCGATGCCCCCGGGCTCGGCATGGTGGAGTCTGTCGGTCGTCATGGCCCCGCGGTGGCTTCGCCTGCGTGTGGCCTCGTGTGACTGGAGGAAAGGTGGACACCTGGCAGAGCCGGGACTGAGGCCCTGGGGGCCTGTGAAGCCGCCTTCTGTCTTCTCTCGGGTCCGAGTGCCAGGAAGCTCCACGGCGGGTCTTGAGTGATCTGTCCTGTCGCGGGAGAAACTCTCGTGGCCGTGGGCGGCTAACGGGTGGCCCCACCATTGTCCGGGTGGCTGCCTCTGTGTCGGTCCGCAGCGAGCTGGGGAGTGGCCTGGGGGGCTGCTGTCCGGGCTGTGGGCACAGCTGTCTCCTGGGACGCTCCTCCGGGCCTTCAGCACTGCCACCACCGGGGCATCCCTGGGCATGCAGGGCGGCCGTGGCGTGTGGTCACAGGGCGCCACCCCGTCTCCTCTGACCAGGAACCCTGACCTCAGGGACGCCCCAGTGGCCATGGGCACGGGGGGCCTTCTGCTGGGCCCGGCAGTCGGGTCTGAAGCCTCGGGCTCTGCCTCCTCCTCAGCTTCGAAGTCAATCCTGAGCACGCACTGGGGCCCTGTGGTGTCACAGCTGGGTATAGTGACATGGGATATTTATTCTGTCCCCATTTGTACAATCAAATATTAGTAAAGTAAGTTTTCTAGAAAGCCA