Transcript asmbl_65342

Sequence
Transcript Sequence for observation asmbl_65342 of TGE0006898:
GGTCATTTAGGGCCCGTATCTGGGTGACTTCTTGGTTGCCCAGTTGCTGTCGGCTCCCCACCCCCAGCTCCTGTGCGGTCCCGCGGGCCTCCCGATTTCGGCTTGCTTTCCCCCTTTCGGGACCTCCCTCTCCGGTTCCCTCTGGGCCTTCAGCCCCTGATTGCCCGGGCTTGCCGCGCCGTCGCTCGTCGCTGTTGTCTGAGGAAAGATGAATGGGAGGGCTGATTTTCGAGAGCCGAATGCTGAAGTTGCAAGACCAATTCCCCACATAGGGGCTGATTACATTCCAACAGAGGAAGAAAGAAGAGTCTTCGCAGAATGCAATGATGAAAGTTTTTGGTTCAGATCTGTGCCTTTGGCTGCAACAAGTATGTTGATTACTCAAGGATTAATTAGTAAAGGAATCCTTTCAAGTCATCCCAAATATGGTTCCATTCCTAAACTCATATTTGCTTGTATCATGGGATACTTTGCTGGAAAGCTTTCTTATGTGAAAACGTGCCAAGAGAAGTTCAAGAATCTTGAGAATTCCCCTCTTGGAGAAGCTTTACGATCAGGACAGGCACGACGATCTTCACCACCTGGACACTACTCTCAAAAGTCAAAATATGACTCAAATGTGAGTGATCATTCATCTTTTGTGACATCACCAGCAGCAGACAACATGGAAAAAGAGATGTTTTCTCATTATGAGCCAGTTCCATTCAGTGCTTCTATGAATGAATCTACTCCCACTGGTATAACTGATCATATTGCGCAAGGTAGAAACTTCTCTTGAAATGAATTTCAGCATTTTATGGTCCAACTCAAAGTAAACAAATATGGAGATACTTGGGATGAGTGAAAAATTGCATCCTTGGACCTACTGAAGGAGTTTCACTGTCCAGCTTCATCTAGGTGGTCATGAATATCTGCATGCTTTGAGCTCAGCAGCAGTCTTCATAAACATTCAAAACTAAAACCTGGGTTTTTGTGTTTTGGCTTATTAAAATGAAGTTTAAAAAACAAATTTTAATGTTACTCTTGTGTAAATGTATTCACATTGGGGAACTATATGAATGATGGTATTATACCATGATAGTACACAGTTTGTGAAATTTAAGTTACAGGGCAAGGATACTCATAAAACTATTGAGATTGTAATGCTCTAGAATCAACATATATGAAAATAAATGATATCTGCATGTTGAATTGGGGTGGGTGGG