Transcript asmbl_6401

Sequence
Transcript Sequence for observation asmbl_6401 of TGE0006793:
CGACGACGGCGGCGGCGGCGGTGGTGGGTCCATCGCTGGACGGCTAAGGGGAAAGCCAGGCCTGAGCTTCTGCATCTAGGATCAGAATGGTTTCAATCCCAGAATACTATGAAGGCAAGAATGTTCTTCTCACTGGAGCTACTGGTTTCCTAGGGAAGGTACTTCTGGAAAAGTTGCTGAGGTCTTGTCCTAAAGTGAATTTAGTGTATGTTCTGGTGAGGCAGAAAGCTGGACAGACACCCCAAGAGCGAGTAGAAGAAGTCATTAGTGGCAAGCTCTTTGACAGATTGAGAGATGAAAATCCAGATTTTAGGGAGAAAATTATAGCAATCAGCAGTGAACTTACCCAACCTATACTGGCTCTTAGTGAAGAAGATAAAGAGATCATCATAGATTCTACCAATATTATATTCCACTGTGCAGCTACAGTAAGGTTTAATGAAAATTTAAGAGATGCTGTTCAGTTAAACGTGATTGCCACACGACAGCTTATTCTCCTTGCACAACAAATGAAGAACCTGGAAGTGTTCACACATGTGTCAACAGCATACGCCTACTGCAATCGAAAGCATATTGATGAAGTAGTCTATCCACCCCCTGTAGATCCCAAGAAACTGATAGATTCTTTAGAGTGGATGGATGATGGCCTAGTAAATGATATCACCCCCAAATTGATAGGAGACAGACCTAATACGTACATATACACAAAAGCATTGGCAGAGTATGTTGTACAACAAGAAGGAGCAAAGCTAAATGTGGCAATTGTAAGGCCATCAATCGTTGGTGCCAGTTGGAAAGAACCTTTTCCAGGATGGATTGATAACTTTAATGGACCAAGTGGTCTCTTTATTGCGGCAGGGAAAGGAATTCTTCGAACAATGCGTGCCTCCAACAGTGCCCTTGCAGATCTCGTTCCTGTAGATGTAGTTGTCAACATGAGTCTTGCGGCAGCCTGGTATTCCGGAATTAATAGACCAAAGAACATCATGGTGTATAATTGCACAACAGGCAGCACTAATCCTTTCCATTGGGGTGAAGTTGAATACCATGTAATTTCCACTTTCAAGAGGAATCCTCTCGAACAGGCCTTCAGACGGCCCAATGTAAATCTAACCTCCAATCACCTTTTATATCAGTACTGGATTGCTGTAAGCCATAAGGCGCCAGCATTCCTGTATGATATCTACCTCAGGATGACTGGAAGAAGCCCAAGGATGATGAAAACAATAACTCGTCTTCACAAAGCTATGGTGTTTCTTGAATATTTCACAAGTAATTCTTGGGTTTGGAATACTGACAATGTCAATATGTTAATGAATCAACTAAACCCTGAAGATAAAAAGACTTTTAATATTGATGTGCGGCAGTTACATTGGGCAGAGTACATAGAGAACTACTGCATGGGGACTAAGAAATATGTTTTGAATGAAGAAATGTCTGGCCTCCCTGCAGCTAGAAAACATCTGAACAAGTTGAGGAACATACGTTACGGTTTCAATACTATCCTTGTGATCCTGATCTGGCGTATTTTTATTGCAAGATCACAAATGGCAAGAAACATCTGGTACTTTGTGGTTAGTCTGTGTTACAAGTTTCTGTCATACTTCCGAGCATCCAGCACTATGAGATACTGAAGACAAGAATTTAGCATTAGAACATCTATGCATATGGTGGTCTAAATGCACAAAACGTAAAATGTACTTAAGTCATGTCATCTTTTGTCAAGACATTAAACCATCTTAGATCAGAGAGTGGAGTAAATTATGGTACATTTTATGTAACGTTTTAATGTTTATGCTCTTAAAAATCTAGTGAACACACTGTGGTATGCCATCTCAATTCTGCAATAGCCACCAAAACCATGACTTAATATTTTGATCCCTCGGGAAAAGGGGTGGGGTGAGGGTAGGAGTGGGGATATAGGAACACTGACCAGTATAACTGTGCAATTCTGGAACATATTAATTAAAATATGCCTTAACATATAGTGAATTTCTAATTCTAATATTGAATGCAATGGAAAGCATTTATTTGGACAGGAATACGAGCTAAGTTGGTAGATATTTGATTCTTCAGTGTTTAATTTTTTTCATCAGTCGATGTGGGTTTTAGTTTTGTTCAAGTTATAGCCAAACTATTTTCACATCATCCTGTAAGTTATCGAGTGGTCTCAGACATGAAAGATGTGTTCTCATTTTTCTTTCTCTGATTAGAGGTCTCATGCATATCATTTTTCTATAAGCAATCAGTTGCTTTCATAATCAGAAGGCTATAATTATTCTAAAGATCCTAATAGATCGAAATGGGCTTGAAAATCCATATCAACATATGCTATGTGTTTTTTGAAGGAAAATTAAAATGAATTCAGTAAGACTTGGCATCAAAAATTAGGATACATTTTTTTGTTCACATTATGGCAAATAAAAATCCTGTGAGATGTTGTTCATGTTTTTAAGATGGAGGATTTCTTGAGACTTTGGC