Transcript asmbl_63912

Sequence
Transcript Sequence for observation asmbl_63912 of TGE0006784:
TGTGAAGCGGCGGAGGAGGTGGTGGCTGCTGTGGGCTCCGGGAAGCTGTTCGCGCAGGGGCTGTCGGCCGCGGGGCGAAGGCACTCGCGCGGGGGGTAACTCGGGTCTGGGTTCAGGTGCCGCGCAGCTCTCCCCGTCTAAAAGTTGGTTTTAATTGGTTGCCCACAGGATTGACTTGGCCTCTACTTCTTGTTAAGAAAATACATCTCTTGTTTTATCAGATGGCCCGCTGCGTGACCTTGGTTCAACTGTCCATTTCCTGTGACCACCTCATCGATAAGGACATCGGCTCCAAGTCTGACCCACTCTGTGTCCTTTTACAGGATGTGGGAGGGGGCAACTGGGTTGAGCTTGGCCGAACTGAGCGAGTACGGAACTGCTCGAGCCCTGAGTTCTCCAAGACTCTGCAGCTTGAATATCACTTTGAAACAGTCCAGAAGCTCCGATTTGGCATCTATGACATAGACAACAAGACACCTGAGCTGGGGGATGACGACTTCTTAGGTGGGGCTGAGTGTTCCCTAGGACAGATTGTGTCCAGCCAGATAATAACTCTGCCTTTGATGCTGAAGCCTGGAAAACCTGCTGGGCAGGGGACCATCACGATCTCATCTCAGGAATTGAAGGATAGTCGTGTAGTGACCATGGAGGTGGAAGCCAGAAACCTAGATAAAAAGGACTTCCTGGGGAAATCTGATCCATTCTTGGAGTTCTTCCGCCAGGGTGATGGGAAATGGCACCTGGCATACAGATCTGAGGTAATCAAGAACAACCTGAACCCTGCATGGAAGCGCTTCTCTGTTCCCCTTCAGCATTTCTGTGGGGGAGACCCTAGCACACCTATCCAGGTACGATGCTCAGACTATGACAGTGATGGTTCACATGATCTCATTGGTACCTTCCACACCAGTTTGGCCCAGCTGCAAGCAGCCCCAGCTGAGTTTGAATGCATCCACCCTGAGAAACAGCAGAAAAAGAAAAGCTACAAGAACTCTGGAACTATTCGTGTCAAGATTTGCCAGGTAGAAACAGAGTATTCATTCCTCGACTATGTGATGGGAGGCTGTCAAGTCAACTTTACTGTGGGTGTGGACTTCACAGGCTCCAATGGAGACCCCTCCTCACCAGACTCCCTGCACTACCTGAGCCCAACAGGGGTCAACGAGTACCTGACAGCACTGTGGAGTGTGGGAAGCGTGATTCAGGACTATGATTCGGACAAGCTGTTCCCAGCATTTGGATTTGGGGCTCAAGTGCCCCCTGACTGGCAGGTCTCCCATGAATTTGCTTTGAACTTCAATCCCAGTAACCCCTACTGTTCAGGCATCCAGGGTATTGTGGATGCCTACCGTCAGGCCCTGCCCCAAGTTCGCCTCTATGGCCCCACAAATTTCGCACCCATCATCAACCATGTGGCCAGGTTTGCAGCCCAGGCTGCACAACAGAGGACTGCCTCGCAATACTTTGTGCTGCTGCTGCTAACCGACGGTGCTGTGACAGATGTGGAGGCCACACGTGAGGCTGTGGTTCGTGCCTCCCACCTGCCTATGTCAGTGATCATCGTGGGTGTGGGCGGTGCTGACTTCGAGGCCATGGAGCAGTTGGATGCTGATGGTGGACCCCTGCGCACACGCTCCGGGGAGGGAGCTGCCCGTGACATAGTGCAGTTTGTGCCCTACCGCCGCTTCCAGAATGCCCCTCGAGAGGCATTGGCGCAGACTGTGCTCGCAGAGGTACCCATGCAACTGGTCTCCTACTTCAAGGCCCAAGGCTGGGCCCCATTCAAGCCGCTTCCACTCCCAGCCAAGGGCCCTGCAGAGGCTCCTCAGGCCTAGATTCCCTTGGAGCGTAGGTTATGGCCAGTCCTCAGCCCTGTGTCCCCACCTCTGAACACACTTGCCAGTGCTAGCAGTTTATATATTTTATACTTTTATACTTGCTCCTGCTATTGCTGCTCTTGATCCCACCTGCTTGCCCCCTGGAGCCCTTCATTCAATAAAGATCAACGATGACCACTGC