Transcript asmbl_63831

Sequence
Transcript Sequence for observation asmbl_63831 of TGE0006772:
CAGCAGCGGGCGCCATGGTGCTGCTGCACGTGCTCTTCGAGCACGCGGTTGGCTACGCGCTCCTGGCGCTAAAGGAAGTGGAGGAGATAAGCCTGCTGCTACCGCAGGTGGAGGAGTGCGTACTTAACCTAGGCAAGTTCCACAACATCGTTCGTCTCGTGGCCTTTTGCCCCTTTGCCTCGTCCCAGGTTGCCTTGGAAAATGCCAACGCTGTGTCTGAAGGTGTTGTTCATGAGGACCTCCGCCTGCTCTTGGAGACTCACCTGCCATCCAAAAAGAAGAAAGTACTTTTGGGGGTTGGGGACCCCAAGATTGGTGCTGCTATACAAGAGGAGTTAGGGTACACTTGCCAGACTGGAGGCGTGATAGCTGAGATCCTTCGAGGAGTTCGTCTGCACTTCCACAACCTGGTGAAGGGTCTGACCGATGTGTCTGCTTGTAAAGCCCAGCTGGGGCTGGGACACAGCTATTCTCGTGCCAAAGTTAAGTTTAATGTGAACCGGGTGGACAATATGATTATCCAGTCCATTAGCCTTCTGGACCAGCTGGATAAGGACATCAATACCTTCTCCATGCGTGTCAGGGAGTGGTACGGGTATCACTTTCCTGAACTGGTGAAGATCATCAATGACAATGCTACGTACTGCCGCCTTGCTCAGTTCATTGGGAACCGGAGAGAGCTGAATGAAGAAAAGTTGGAGAAGCTGGAGGAGCTAACAATGGATGGGGCCAAGGCTAAGGCTATTCTGGATGCCTCGCGGTCCTCCATGGGTATGGACATATCAGCCATAGACTTGATAAACATCGAGAGTTTCTCCAATCGTGTGGTGTCTTTGTCAGAGTACCGCCAGAGCCTGCACACTTATCTGCGATCCAAGATGAGCCAAGTAGCCCCCAGCCTGTCAGCCCTAATTGGGGAAGCGGTAGGCGCACGTCTCATTGCTCATGCTGGCAGCCTCACCAACCTGGCCAAGTATCCAGCATCCACAGTGCAGATCCTTGGGGCTGAAAAGGCCCTGTTCAGGTACCAGTGAGGGCACTTGCCCACACTCAGGTACCACTTCTGGTGCCCACTGCTTGTTTGGGGATCACAGTGATGGCTGACCAGGGCTTCCTGACCTATACAGGCCTCTGCTATGGGGGTGATGGCCAGTCCTGGTGTCTGAGTGATTCCCAGGGCCCAGCAAAGGGACCGAGTTTCCAGGTCAGCGACATTGGATGCCTTCCCTCTGTCTCTGGGAGCTGTGGGTTTGCATGAGGCGGGATAGAGACCCAGCCTAGCCGGAGGCTCACTCTGGAGACACGGGAGGGGAGGGGAGGAAAGGAGCTGCCTTGGCTAATAGGGTTGAAATTTCTGATCTTAAACTCTTTGCTGAATATTCTTCTCCCAGAGCCCTGAAGACAAGGGGTAACACCCCAAAATATGGACTCATTTTCCACTCCACCTTCATTGGCCGAGCAGCTGCCAAGAACAAAGGCCGCATCTCCCGATACCTGGCAAACAAATGCAGTATTGCCTCACGAATTGATTGCTTTTCTGAGGTGCCCACAAGTGTATTTGGGGAGAAGCTTCGAGAACAAGTGGAGGAGCGGCTATCCTTCTATGAGACCGGAATTTTTCCACGGAAGAACCTGCAGGTTATGAAGGAAGCCATGGTTCAGGCAGAGGAGGCGGCTGCTGAGATTACTAGGAAGCTGGAGAAACAGGAGAAGAAACGCTTGAAGAAAGAAAAAAAACGGTTGGCCGCCATTGCTCTTGCATCTCCAGAAAACAGCACTAGTACGCCAGAGGAGTGTGAGGAGATAAGTGAAAGACCCAAAAAGAAGAAAAAGCAAAAGCTCCAAGAGGCTCCTCAGGAGAATGGAATGGAAGAGCCACCTGTCTCTTTAGCCAAACCCAAGAAAAAGAAAGCTTTTTCCAAGGAGGAGCTGATCAGTAGTGATTTAGAAGAAACAGCTGGCAGTGGAAGTCTTCCCAAGAGGAAGAAATCTTTCCCCAAAGAAGAACCAGTTAGTGACCCTGAAGAGGCAGAAAACAGGAGTGTCCCTAAAAAAAAGAGGAAATTTAAGGAGGAGCTGCTCAGCAGTGGACCTGAAGAAGCTGCTAGCAGCAAGAGCAGTAGCTCCAAGAAAAAGAAAAAGCTGCAGAAGCTATCCCAGGGAGATTAGAATGGACAGTGCCCTGGTGGGACATAACCACCCACAGTGACATTTCCCAACCCATCCCTTATATCCCAATAAAAACATTCACAAGCTG